ID: 1195159140

View in Genome Browser
Species Human (GRCh38)
Location X:102154592-102154614
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195159140_1195159145 26 Left 1195159140 X:102154592-102154614 CCTTCTTCCCTCATCAGATACAG 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1195159145 X:102154641-102154663 AGTTTCTCCTGCACTCAACTCGG 0: 1
1: 0
2: 1
3: 7
4: 145
1195159140_1195159146 27 Left 1195159140 X:102154592-102154614 CCTTCTTCCCTCATCAGATACAG 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1195159146 X:102154642-102154664 GTTTCTCCTGCACTCAACTCGGG 0: 1
1: 0
2: 0
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195159140 Original CRISPR CTGTATCTGATGAGGGAAGA AGG (reversed) Intronic
900002779 1:24033-24055 CTGCATCTGTTCAGGGGAGATGG - Intergenic
900022500 1:194558-194580 CTGCATCTGTTCAGGGGAGATGG - Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
903302661 1:22390375-22390397 CTCTTTCTGATGAGGAAACAAGG + Intergenic
903825910 1:26145728-26145750 CTGTATCTGGTGATTGAAGGAGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904235986 1:29117560-29117582 CTGCTTCTGATGAGGTAAAAGGG - Exonic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906871936 1:49492690-49492712 CTGGATCCCATGAGGGATGAAGG - Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
910670574 1:89769011-89769033 CTGTATCTCAAGAGGAAATAAGG + Intronic
913570002 1:120110379-120110401 CTAAATCTGCTGAGGGGAGAGGG - Intergenic
913580038 1:120217282-120217304 CTGTATCTGACGTTGGGAGAGGG - Intergenic
913628136 1:120681110-120681132 CTGTATCTGACGTTGGGAGAGGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914561966 1:148828714-148828736 CTGTATCTGACGTTGGGAGAGGG - Intronic
914610863 1:149301499-149301521 CTGTATCTGACGTTGGGAGAGGG + Intergenic
915086646 1:153393914-153393936 CTGTACATGATGTGGGAAGGAGG - Intergenic
915120954 1:153629279-153629301 CTGTGGCTGATGAGGGGATAAGG - Intronic
915353595 1:155241872-155241894 CTGCATCTGATGATGAAACAAGG - Intronic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916439673 1:164811060-164811082 ATGAATCTGGTGAGGGAAGGGGG - Intronic
920283553 1:204862242-204862264 CTTTATCCTATGAGGGTAGATGG - Intronic
921860637 1:220039035-220039057 CTCTATATGATGGGGGAAGTGGG + Intronic
922887228 1:229029315-229029337 CTGTATCTGGTGGGAGGAGATGG + Intergenic
923850094 1:237784856-237784878 CTGGATCTGAAGAGAGAAGGAGG + Exonic
1063424045 10:5937480-5937502 ATGTATCTGGTCAGGGAAGTGGG + Exonic
1063926841 10:10986869-10986891 CTATATCAAAGGAGGGAAGAAGG + Intergenic
1064955626 10:20905553-20905575 CCGTATGTGTTGAGGGAAGGAGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066219167 10:33318915-33318937 GTGTAACTGATCATGGAAGAGGG + Intronic
1067975944 10:51025352-51025374 CTTTATCTGATCAGGGGAAAGGG + Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1069945094 10:71980028-71980050 CTGTATCGGATGGGGAAAGAGGG + Intronic
1071167525 10:82823717-82823739 TTGTCTGAGATGAGGGAAGAGGG - Intronic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1071777579 10:88806398-88806420 ATGTGTCAGATGAGGGATGAAGG - Intronic
1074752333 10:116598786-116598808 CTGTATCTAATGAGGCCAAAAGG + Intronic
1075955537 10:126520075-126520097 CTGTTTCTGATGAGGGCAACAGG - Intronic
1077718282 11:4602407-4602429 CTGTATCTGTGGAGCCAAGATGG + Exonic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1081033349 11:38113351-38113373 CTGTCTCTGATGGGGAAAAATGG + Intergenic
1081302583 11:41470679-41470701 TTGTGTCAGATGAGGGAAGTGGG + Intergenic
1082660592 11:55905156-55905178 TTCTATTTGATCAGGGAAGAGGG - Intergenic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1083092327 11:60212763-60212785 CTATATGTGATGAGGCAAAATGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1085169378 11:74435495-74435517 CTGTCTCTGATAAGGGGAGGGGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1087339210 11:96881229-96881251 ATGTGTCTCATGAGGAAAGAAGG - Intergenic
1089568334 11:119384955-119384977 ATGTCCCTGATGAGGGGAGAAGG + Intergenic
1090956042 11:131513567-131513589 CTGTATCTGACAGTGGAAGAAGG - Intronic
1091047376 11:132336731-132336753 CTGGATGTGATGAGGGAAAGGGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091376198 12:26096-26118 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1091950655 12:4590432-4590454 CTGTATCAGGTGAGTGCAGACGG + Exonic
1092472221 12:8790130-8790152 CTCTCTCTGATGAGGAAAAATGG + Intergenic
1095155689 12:38851036-38851058 CTGTATCACATGGTGGAAGACGG - Intronic
1095757040 12:45780527-45780549 ATTTATCTGAGAAGGGAAGAAGG + Intronic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1099070081 12:78035280-78035302 CTTTATCAAATGAGGGAAAATGG - Intronic
1100029536 12:90169022-90169044 CTGAACTTGATGTGGGAAGAAGG - Intergenic
1100706041 12:97201517-97201539 TTGTATTTGATGAGTGAAGGTGG + Intergenic
1102576191 12:113857575-113857597 CTGTCTCTGATGAGAGGCGAGGG + Intronic
1103917054 12:124381173-124381195 CAGTCTCTGAGGAGGGGAGAGGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106869544 13:34003723-34003745 CTGTATGTGATTAAGGCAGATGG + Intergenic
1107630135 13:42334502-42334524 CTGAATCTGAGGAGGGAACCTGG - Intergenic
1107686693 13:42908061-42908083 TTGTATGTGATGAGAGAAAAGGG - Intronic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1108279541 13:48847850-48847872 CTGACTCTGATGAGGGAGAAAGG - Intergenic
1108866931 13:54935446-54935468 CTTTATCTCATGAATGAAGAAGG - Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110805848 13:79753295-79753317 GTGTATCTGATGAAGGACTATGG + Intergenic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113336082 13:109377215-109377237 GTGTGTCTGCTGAGGCAAGAGGG - Intergenic
1113631041 13:111884080-111884102 CTGTCTCCCATGAGGGCAGATGG - Intergenic
1115071190 14:29323424-29323446 CTGAATTTGATGAGGGATGTTGG + Intergenic
1116374902 14:44186305-44186327 ATGTATCTCATGGGGGAATATGG + Intergenic
1117412801 14:55466041-55466063 ATGGATCACATGAGGGAAGAAGG + Intergenic
1118355406 14:65009493-65009515 AGGTCTCTGATGTGGGAAGAAGG - Intronic
1120999344 14:90440311-90440333 CTGCATCTGCTGAGGGAACGAGG + Intergenic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1125403281 15:39327144-39327166 TTGTATCTGATGGGGAGAGAGGG + Intergenic
1125901659 15:43353780-43353802 CTGTACCTGAAGAGGGTAGAGGG + Exonic
1126651702 15:50929571-50929593 CTGTATCATATGAGGAAAGAGGG + Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128571391 15:68735930-68735952 CAGTATCTGATGAGATAAGGTGG - Intergenic
1131656082 15:94460641-94460663 ATGTGTCTGAGGAGAGAAGAGGG + Intronic
1132450732 15:101966906-101966928 CTGCATCTGTTCAGGGGAGATGG + Intergenic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1135791113 16:25396981-25397003 CTGTATTTGAGGCAGGAAGATGG + Intergenic
1135942991 16:26839113-26839135 CTGAATCTAATGAGCGAAGCAGG - Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1137373703 16:47932634-47932656 CAATTTCTGAGGAGGGAAGAGGG - Intergenic
1141286118 16:82673707-82673729 CTGTATATGTTGAGGGCAGGAGG + Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1148761401 17:50003587-50003609 CTGTGTCCGGTGAGGCAAGAGGG + Intergenic
1151897040 17:76987443-76987465 CACTCTCTGATGAAGGAAGATGG + Intergenic
1154260553 18:12828499-12828521 TTGTATATGATATGGGAAGAAGG + Intronic
1154348668 18:13565291-13565313 CTGTCTGGGATCAGGGAAGATGG - Intronic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1157445749 18:47745643-47745665 CTGTAACCCACGAGGGAAGATGG - Intergenic
1158379675 18:56915516-56915538 CTGGATCTGAATAGTGAAGAAGG - Intronic
1160429418 18:78801225-78801247 CTGCATCTGGTGAGTGAAGCTGG - Intergenic
1160514889 18:79472743-79472765 CAGGATCAGATGAGGGAAGGCGG - Intronic
1160622669 18:80181624-80181646 CAGTCGCTGATGAGGGAGGATGG - Intronic
1160634530 19:65641-65663 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164237285 19:23348199-23348221 CAGAATCTCATGAGGGAAAAAGG - Intronic
1164639652 19:29814650-29814672 CTGTATGTGAGCAGGGAAAAAGG - Intronic
1164887116 19:31788613-31788635 CTGTATCTGATGAGGGACTCAGG - Intergenic
1165028289 19:32978034-32978056 CTGCATCTAGTGAGGGAAGCAGG + Exonic
1165779477 19:38423909-38423931 CTGTTCCTGATAGGGGAAGAGGG + Intronic
1167560779 19:50225762-50225784 GTGGATCTGTTGAGGGAGGAGGG + Intronic
1168059366 19:53882656-53882678 CTTCATCTGGTGAGGGAAGGGGG + Exonic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925293887 2:2765503-2765525 CTGTATCTGTGGGGAGAAGAGGG - Intergenic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925719410 2:6813150-6813172 CTGTAGCTGATGTTGGAGGAAGG - Intergenic
928294246 2:30069194-30069216 AAGTGTCTGATGAGGGAAGGAGG - Intergenic
929514086 2:42590450-42590472 CTGCATCTGATGAAGGAATCAGG - Intronic
930093216 2:47546865-47546887 CTGTAACTGATGAAGGCAGGTGG + Intronic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
931894584 2:66714751-66714773 CTGTAGCTGAGGAGTCAAGATGG + Intergenic
932303320 2:70683833-70683855 CTGTATGTGATGAGAGAATGGGG + Intronic
933373137 2:81442739-81442761 CTATATCTGATGAGGGCATAAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
935013977 2:99162213-99162235 CTGAATCTAATGAGAGAAGAAGG + Exonic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936566945 2:113589386-113589408 CTGCATCTGTTCAGGGGAGATGG + Intergenic
936605513 2:113948509-113948531 CTGTCTGTGATGACAGAAGAAGG - Intronic
937726145 2:125168636-125168658 CTGGATCTGATGTAGGAAGAGGG + Intergenic
937818703 2:126283501-126283523 CTTTAGCTGATTAGGGAAAAAGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
945262272 2:207854747-207854769 CTGCATCTGATCAAGGAAGAAGG + Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
947295319 2:228624381-228624403 CTTTATCCTATGAGGGAACATGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1171234284 20:23511568-23511590 CTGGCTCTGAGGATGGAAGAAGG - Intergenic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173531868 20:43775938-43775960 ATGTATGTGATGAGTGAGGAAGG - Intergenic
1173555062 20:43960235-43960257 CTGGATCTGAGGAGGGACTAGGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1175069481 20:56320674-56320696 TTGTATATGATGAGAGATGAGGG - Intergenic
1175910294 20:62402093-62402115 CTGCATCTGACTTGGGAAGAAGG + Intronic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177820595 21:26027158-26027180 CTTGCACTGATGAGGGAAGAGGG + Intronic
1181022133 22:20109119-20109141 CTGTATCTGATTTTGGAAGGAGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181492879 22:23271708-23271730 CTCTATCTGAAGAGAGAACAGGG - Intronic
1181906781 22:26203936-26203958 CTACATTTGATGAGGCAAGAGGG + Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184440135 22:44506168-44506190 CTGCTTCTGGTGAGGGCAGAAGG - Intergenic
949634306 3:5966253-5966275 CTGAATGTGATAAGGAAAGAGGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951700851 3:25495238-25495260 GGGTATCAGAGGAGGGAAGATGG + Intronic
951914694 3:27788077-27788099 TTTTATCTCATGAGGAAAGAGGG - Intergenic
953193988 3:40714868-40714890 CTGAGTCAGATGAGGGAAAAAGG + Intergenic
953682520 3:45050622-45050644 CTGTATCTGGTGAGGGCATCAGG - Intergenic
955012769 3:55035882-55035904 CAGTAACTGATGAGTGAGGATGG + Intronic
955235319 3:57134239-57134261 CTGGATCTGCTGATGGAAGTTGG - Intronic
956062440 3:65361216-65361238 CTGTTTCTGAAGCGGGGAGACGG - Exonic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
961125716 3:124415947-124415969 CTGTACCTTATTAGGGAAGTAGG + Intronic
962064172 3:131961868-131961890 CTGGATCTGAGTAGGGAAAAGGG - Intronic
962714646 3:138115709-138115731 CTGTAACGGATGGGGGAAGGCGG + Intronic
964305435 3:155334466-155334488 CTTTATCTGCTGAGGGTATAAGG + Intergenic
964812108 3:160676663-160676685 CTGTATGTGATTAGGGAGTAAGG + Intergenic
965259992 3:166469707-166469729 AACTATCTGAGGAGGGAAGAGGG - Intergenic
967290416 3:187914428-187914450 ACATATCTGGTGAGGGAAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970481055 4:16475348-16475370 CTATAGCTAATGAGCGAAGAAGG + Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
972152713 4:36114412-36114434 CTGTATGGGATTAGGGAAGCTGG - Intronic
972335730 4:38106062-38106084 CTGTATCCTATAAGGGAAAAAGG - Intronic
972693533 4:41422599-41422621 CTATATCTGAAGAAGGAAAAAGG - Intronic
972721396 4:41702805-41702827 CTGCATCTGATGAGGGCTGCAGG + Intergenic
974526457 4:63054706-63054728 CTCTCTCTGATGAGGAAAAATGG + Intergenic
974565711 4:63576727-63576749 TTGTCTCTGGTAAGGGAAGAAGG + Intergenic
976473216 4:85453786-85453808 ATGTATCTGATAAATGAAGATGG - Intergenic
977423716 4:96837919-96837941 CTGTATCTTAACATGGAAGAAGG - Intergenic
977466227 4:97385144-97385166 CTTTAACTAAAGAGGGAAGAAGG + Intronic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
979573801 4:122262456-122262478 CTTAATCTGATGAGGGAATCTGG - Intronic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
982002676 4:151035597-151035619 CAGTTTCTGATGGGGGAAGTGGG + Intergenic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
982699745 4:158647137-158647159 CTGTATCTTCTGAATGAAGAGGG - Exonic
983045340 4:162980245-162980267 CTACCTCTGAGGAGGGAAGAGGG - Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983435229 4:167706681-167706703 CTGGATCTGAAGGGGAAAGAAGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985985570 5:3513325-3513347 TTGTATCTGAGCAGGGAACAAGG - Intergenic
989199814 5:38752038-38752060 CTACCTCTGAGGAGGGAAGAGGG + Intergenic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
990232870 5:53734048-53734070 CTGGAACTGCTGAGGGAGGATGG - Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992623022 5:78611882-78611904 CTGTATCACATGTGGGAAAATGG - Intronic
995481790 5:112600498-112600520 CTTTATCTAATCAGGGAAGCAGG + Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996347864 5:122507011-122507033 CTGTCTCTGACAAGAGAAGATGG + Intergenic
996493380 5:124125567-124125589 CGATACCTGATGAGGGAAAACGG - Intergenic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
997072297 5:130635459-130635481 CTCTCTCTGATGAGGAAAAATGG + Intergenic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997958952 5:138303985-138304007 CTGTATCTGGTGAGAAAAGAAGG + Intronic
1000570857 5:162912215-162912237 CTGTATCTGATGGGGATTGAGGG - Intergenic
1000618532 5:163457569-163457591 CAATAGCTGATGAGGGAACATGG - Exonic
1000879685 5:166682898-166682920 CTGTATATGTTGTGGGGAGAGGG + Intergenic
1001441061 5:171743394-171743416 CTATAGCTGAAGTGGGAAGATGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1003050760 6:2779040-2779062 CTGTATCTTATGAGTGTCGAGGG - Intronic
1003850035 6:10212346-10212368 AGGTATGTGATGAGGGAAAATGG - Intergenic
1004914900 6:20322438-20322460 CTGTATCTGCTGAGGAAAAATGG + Intergenic
1006314326 6:33280982-33281004 ATGTACCTGGTGAGAGAAGAGGG + Exonic
1006361905 6:33591409-33591431 CTGTATCTCAGGTGGGATGAAGG + Intergenic
1006728506 6:36217486-36217508 CTTTATCTGAAGAGGCAAGGTGG + Intronic
1006856006 6:37133779-37133801 CTGAATCTGAGGAGAGAACATGG + Intergenic
1007053036 6:38852379-38852401 CTGTATCTGTCGGGGGAGGAGGG + Intronic
1007426074 6:41747029-41747051 CCCCATCTGATGAGGAAAGATGG - Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011818395 6:91220976-91220998 ATGTATGTGATTAGGGAAAATGG - Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1014448924 6:121561004-121561026 CTTTATCTGATGAAAGAAAATGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015074539 6:129139613-129139635 CTATAACTGATGAGGGGTGATGG + Intronic
1016120443 6:140337043-140337065 TTGTCTCTGATTAGGGAAGTAGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1020763206 7:12292173-12292195 TTATCTCTGATTAGGGAAGAAGG - Intergenic
1021673563 7:23057821-23057843 CTGGATCTGGGAAGGGAAGAAGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1024177483 7:46856011-46856033 AGGCATCTGATGAGGGAAGGAGG - Intergenic
1025746656 7:64248792-64248814 CTGGCTCAGATCAGGGAAGAAGG + Intronic
1027230612 7:76269679-76269701 GTTTAGCTGGTGAGGGAAGAGGG + Intronic
1027580592 7:79990101-79990123 CTGTATCTGTTAAGTGGAGATGG - Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032714324 7:134492008-134492030 CTGAAACTGAAGAGGAAAGAGGG - Intergenic
1032856309 7:135836547-135836569 GTGTTTCAGATAAGGGAAGAAGG + Intergenic
1033614132 7:142995488-142995510 GTGTATGTGATGAGGGATAATGG - Intergenic
1033772088 7:144564011-144564033 CTGGCACTGCTGAGGGAAGAAGG + Intronic
1036717248 8:11137222-11137244 CTGTATGTGGTGAGGAAAGCGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037982979 8:23268323-23268345 CTGTATCTGAGGTAGGAAGTGGG + Intergenic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1045594969 8:103644027-103644049 CTGTATCTAATAGGGGGAGAAGG - Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049530148 8:143150177-143150199 CTGTAACTGATGAGTGAGCATGG - Intergenic
1049885584 9:24146-24168 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1050583972 9:7090728-7090750 CTATACCTGCTGAGGGAAGGAGG - Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051935154 9:22436404-22436426 CTGTCTCTGATGGGGAAAAATGG + Intergenic
1052575347 9:30283434-30283456 TTGTCTCTAATTAGGGAAGAAGG + Intergenic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1056179126 9:84064543-84064565 CAGTTTCTGGTGAGGGCAGATGG + Intergenic
1057426175 9:94951502-94951524 CAGGATCTTATGAGGGAAGAGGG + Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058303814 9:103410902-103410924 CTGTATCTCAAGTGGAAAGAAGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058669725 9:107350648-107350670 CTGGGTCTGATGAAGGAAGCTGG - Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1061106251 9:128532867-128532889 GTGTCTCTGAGGACGGAAGAAGG + Intronic
1187797946 X:23024818-23024840 CAGAATCTGATGAGGTAAGCAGG - Intergenic
1190539276 X:51460368-51460390 CAGTATCTGGTGAGGTAGGAGGG - Intergenic
1192099542 X:68249586-68249608 CTTTATTTGATCAGAGAAGAAGG - Intronic
1194232501 X:91341523-91341545 CTGTATCTGCTAAGGAATGATGG - Intergenic
1194236677 X:91392856-91392878 CTGAATCTGATGATGGAAGAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195583584 X:106535994-106536016 CTGGCTTTGATGATGGAAGAAGG + Intergenic
1196523513 X:116703273-116703295 TTGTATCTGATGAGAGATAAGGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1200925124 Y:8647484-8647506 CTCCACCTGATGAGGGAAGTTGG + Intergenic
1201509911 Y:14747429-14747451 CTGCTTCTGATGAGGGACTAAGG - Intronic