ID: 1195164048

View in Genome Browser
Species Human (GRCh38)
Location X:102199781-102199803
Sequence GTTGAAGCACAGAGGTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195164046_1195164048 -2 Left 1195164046 X:102199760-102199782 CCAATTTTACAGATGAGGACAGT No data
Right 1195164048 X:102199781-102199803 GTTGAAGCACAGAGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195164048 Original CRISPR GTTGAAGCACAGAGGTCACT TGG Intergenic
No off target data available for this crispr