ID: 1195168079

View in Genome Browser
Species Human (GRCh38)
Location X:102239784-102239806
Sequence CCTGTCCCGCCACTGTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2043
Summary {0: 2, 1: 9, 2: 66, 3: 326, 4: 1640}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195168079_1195168084 16 Left 1195168079 X:102239784-102239806 CCAAAATACAGTGGCGGGACAGG 0: 2
1: 9
2: 66
3: 326
4: 1640
Right 1195168084 X:102239823-102239845 TCATTCCAAGAGGGAGAGACAGG 0: 2
1: 0
2: 8
3: 115
4: 902
1195168079_1195168086 28 Left 1195168079 X:102239784-102239806 CCAAAATACAGTGGCGGGACAGG 0: 2
1: 9
2: 66
3: 326
4: 1640
Right 1195168086 X:102239835-102239857 GGAGAGACAGGCAACAGAAAAGG 0: 2
1: 0
2: 5
3: 60
4: 743
1195168079_1195168082 6 Left 1195168079 X:102239784-102239806 CCAAAATACAGTGGCGGGACAGG 0: 2
1: 9
2: 66
3: 326
4: 1640
Right 1195168082 X:102239813-102239835 ATAGACATTCTCATTCCAAGAGG 0: 2
1: 17
2: 83
3: 199
4: 493
1195168079_1195168083 7 Left 1195168079 X:102239784-102239806 CCAAAATACAGTGGCGGGACAGG 0: 2
1: 9
2: 66
3: 326
4: 1640
Right 1195168083 X:102239814-102239836 TAGACATTCTCATTCCAAGAGGG 0: 2
1: 13
2: 111
3: 278
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195168079 Original CRISPR CCTGTCCCGCCACTGTATTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr