ID: 1195173912

View in Genome Browser
Species Human (GRCh38)
Location X:102296573-102296595
Sequence AGCATTCATATTTCTACCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 0, 2: 3, 3: 14, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195173912_1195173916 28 Left 1195173912 X:102296573-102296595 CCGTTGGTAGAAATATGAATGCT 0: 2
1: 0
2: 3
3: 14
4: 201
Right 1195173916 X:102296624-102296646 GGAAGTGAGAAGAGTTGTAGAGG 0: 2
1: 0
2: 0
3: 31
4: 287
1195173912_1195173914 7 Left 1195173912 X:102296573-102296595 CCGTTGGTAGAAATATGAATGCT 0: 2
1: 0
2: 3
3: 14
4: 201
Right 1195173914 X:102296603-102296625 ATTCTTGTGAGAGCTCCAGAAGG 0: 2
1: 0
2: 2
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195173912 Original CRISPR AGCATTCATATTTCTACCAA CGG (reversed) Intergenic
906974928 1:50560020-50560042 AGAATCCATATTTGTACCTAGGG + Intronic
908054593 1:60269879-60269901 AGCTTTCATGTATTTACCAATGG + Intergenic
909093813 1:71261526-71261548 AACATTCATATTTCAAGCAGTGG + Intergenic
910629945 1:89344173-89344195 AGCAGTCAGATTTCTCCCAGAGG - Intergenic
911688113 1:100800559-100800581 AGCATTCATATTTCTGCACTTGG - Intergenic
912864368 1:113244251-113244273 TGCATTCAGATTTCTAACATGGG + Intergenic
917619546 1:176782084-176782106 AGCATTCAGGTTTCTACCAATGG - Intronic
917636050 1:176937543-176937565 AGCATTTATATTTATAGTAATGG - Intronic
917832537 1:178908232-178908254 TGCATTCATGTTGCTGCCAAGGG + Intronic
922328090 1:224547695-224547717 ATTATTCATATATCTACTAAGGG + Intronic
923989565 1:239420697-239420719 AGCAGGCATAGTTCTCCCAAAGG - Intronic
924862140 1:247936251-247936273 AGCAGAAATATTTCTACAAATGG - Intergenic
1063040889 10:2336323-2336345 AGCATTTGTATTTCTACTAGAGG + Intergenic
1063595385 10:7430473-7430495 AGCATGCATATTTCCATCCATGG + Intergenic
1067183797 10:44010183-44010205 AGCAGGCACATTTCTGCCAAGGG - Intergenic
1067826943 10:49582483-49582505 AGCATTCCTATTTCTAACCTTGG - Intergenic
1068114421 10:52721317-52721339 AGTATTCATATTTCTAGTATGGG + Intergenic
1068311320 10:55280168-55280190 TGAATTCACATTTCTTCCAAAGG - Intronic
1068550201 10:58399423-58399445 AGCCTTCATATTTTTAGAAAGGG + Intergenic
1071285744 10:84142928-84142950 ATCAATCATATTTCTTCCAGTGG + Intronic
1071451156 10:85792365-85792387 TGTATTCATATTTCCACCAGTGG + Intronic
1072586324 10:96786000-96786022 AGCTTGAATATTTCTAGCAATGG + Intergenic
1073850303 10:107608970-107608992 AGCATTTTGATTTCTACAAAGGG - Intergenic
1074583316 10:114742158-114742180 AGCATTCATATTTCATTAAAAGG - Intergenic
1075748825 10:124746970-124746992 AGCAATCCTAGTTCTCCCAAAGG + Intronic
1075783430 10:125032171-125032193 AGGATTCCCATTTCTAGCAATGG + Intronic
1080143780 11:28954603-28954625 AGCATGCCTATTTATAGCAATGG + Intergenic
1081570620 11:44288560-44288582 ACCATTCATAATTCTACAAGGGG + Intronic
1086661171 11:89420422-89420444 AGCAGTCTTTTATCTACCAAGGG + Intronic
1086664175 11:89459148-89459170 GCCATTCATATTTCTTGCAAAGG - Intronic
1090710510 11:129380595-129380617 AGCATTTGTATTTCTGCCAGAGG + Intronic
1093188808 12:16051797-16051819 TCAATTCATATTTCTACCACTGG - Intergenic
1094070135 12:26403822-26403844 AGCATACATTTTTCTACCTCTGG - Intronic
1094223946 12:28025235-28025257 AGTGTTCATATGTCTACCACTGG - Intergenic
1095310876 12:40694875-40694897 AGCATGCATGTTTCTATCATGGG + Intronic
1097356059 12:58603130-58603152 ATCCTCCATATTTCAACCAAAGG - Intronic
1098446382 12:70569899-70569921 AATATTCACATTTCTCCCAATGG - Exonic
1100649024 12:96564488-96564510 AGCAAAGATATTTCTACCAAGGG + Exonic
1102826941 12:115955452-115955474 AGCATTAATATTGCTAGAAATGG + Exonic
1106310366 13:28548948-28548970 AGTATTCATATTACCACAAATGG - Intergenic
1107211503 13:37861923-37861945 TGCATTCCTAGGTCTACCAATGG - Intronic
1109023674 13:57132060-57132082 AGCATTCATATTTCTGTACAAGG - Intergenic
1111184339 13:84711845-84711867 ACCATTCATTTTACTACCATGGG + Intergenic
1111244130 13:85512584-85512606 AGTATTCACATTTTTCCCAATGG - Intergenic
1111437643 13:88231894-88231916 GTCATTCATATATCTACAAATGG + Intergenic
1112128609 13:96497186-96497208 AGCACACATATATCTACCACTGG - Intronic
1114003031 14:18281817-18281839 AGCATTTAAATTTCTCCAAATGG - Intergenic
1114453084 14:22838934-22838956 AGCCTTCATTTTTCTCCCGAGGG + Intronic
1115034917 14:28845653-28845675 AGCCTGCACATGTCTACCAAAGG - Intergenic
1116219474 14:42064277-42064299 TGCATCCATATTGCTGCCAAGGG + Intergenic
1116420602 14:44727747-44727769 TCCAGTCATATTTCTACCATGGG + Intergenic
1116801654 14:49450331-49450353 AAAATTCAAATTTCTACCCAAGG - Intergenic
1117695310 14:58356155-58356177 AGCACTAATATTGCTAACAAAGG - Intronic
1117885160 14:60353711-60353733 AGCCCTCACATTTCAACCAAGGG + Intergenic
1118551133 14:66951709-66951731 AGAATTAATATTTAGACCAATGG + Intronic
1119132582 14:72188122-72188144 AACACTCATATTTCTTCCCAAGG - Intronic
1123388138 15:19840100-19840122 AGCATTTAAATTTCTCCAAATGG - Intergenic
1126378067 15:48016438-48016460 ACCATTCATACTTCCACCAAGGG + Intergenic
1127476814 15:59341967-59341989 CTCATTTATATTTCCACCAACGG + Intronic
1128986677 15:72227097-72227119 AGCTTGCATTTTTTTACCAAGGG - Intronic
1129301642 15:74628944-74628966 AGCAGAAATATTTCTACAAAGGG + Exonic
1131674023 15:94652831-94652853 ACTATTAATCTTTCTACCAAGGG - Intergenic
1133646644 16:7770645-7770667 AGCATTCATATTTGGAGCCAAGG - Intergenic
1143075133 17:4335666-4335688 AGCATGCATATTTCAATCAATGG + Intronic
1143538470 17:7555942-7555964 GGCATTTTTATTTCCACCAATGG - Intronic
1148656082 17:49284753-49284775 AGTATCCATATTTCTAAGAAAGG + Intergenic
1149361636 17:55901591-55901613 AGCCATCATTTTTCCACCAAGGG - Intergenic
1154534099 18:15380047-15380069 AGCATTTAAATTTCTCCAAATGG + Intergenic
1155710578 18:28872684-28872706 AGCATTCATACTTCTGCAAGAGG - Intergenic
1157312469 18:46562402-46562424 AACATTCATGTTTCTCCTAAGGG + Intronic
1165985540 19:39765723-39765745 AGCATTTATTTGTTTACCAAAGG - Intergenic
928895763 2:36261196-36261218 AGCATTCAAAATTCTAGCCATGG + Intergenic
929047389 2:37803299-37803321 AGCATTCATATATCTAAACATGG + Intergenic
930632476 2:53768351-53768373 AGCATTCATCTTCCCGCCAATGG - Intronic
930747001 2:54895150-54895172 AGCCTTGACATTTCTACCAGAGG - Intronic
930914404 2:56669707-56669729 TGCATCCATGTTTCTGCCAAGGG + Intergenic
931354536 2:61523709-61523731 AGCATTAGTATTTCAACCAAAGG + Intronic
933398897 2:81766059-81766081 AGTATTTCTATTTCTGCCAAAGG - Intergenic
936377876 2:111957806-111957828 AGTGTCCATCTTTCTACCAAAGG - Intronic
936660780 2:114541277-114541299 AGCATTCATATTCCATCCAGTGG + Intronic
936820030 2:116509271-116509293 AAAATTCATATCTGTACCAAGGG - Intergenic
936893299 2:117397039-117397061 AGCATTCCTATTTCACCTAAGGG + Intergenic
937493031 2:122389522-122389544 AGCTTTCATATTTCCTCAAATGG + Intergenic
937659770 2:124417444-124417466 AGCATTCATGTTTCCTGCAAAGG - Exonic
938532846 2:132207236-132207258 AGCATTTAAATTTCTCCAAATGG + Intronic
938840584 2:135158485-135158507 AGAATTCCTATTTTTTCCAACGG - Intronic
938922992 2:136012299-136012321 AGTATTAATAATTCTACCCAAGG + Intergenic
939104982 2:137938358-137938380 TGCACTCATATCTCAACCAACGG - Intergenic
940101970 2:150050720-150050742 AGCTTTCATATTTCTTAAAATGG - Intergenic
940269993 2:151880204-151880226 AGCATTCTTCTTTCTATCAAAGG + Intronic
941097566 2:161257236-161257258 AGATTTAATATTTCTTCCAAGGG + Intergenic
941207570 2:162593032-162593054 ATCATTTATATCTCTGCCAAGGG + Intronic
941708174 2:168681938-168681960 CTCATTCATATTGCTACAAATGG + Intronic
942034558 2:171998242-171998264 AGCATTCATTTATTTTCCAAGGG + Intronic
943525758 2:189015246-189015268 AAAATTCATATTTTTGCCAAAGG + Intergenic
944381985 2:199121452-199121474 AGTATTCATGTTTTCACCAAAGG + Intergenic
1170216322 20:13895647-13895669 AGCATTCAGTTTTTTACCATTGG - Intronic
1175559389 20:59907835-59907857 CGCATTCATATTTAAATCAAAGG - Intronic
1175745360 20:61453237-61453259 AGCATTCATTTTTCTGTCATGGG + Intronic
1180106328 21:45620562-45620584 AGTATTCATCATTCTCCCAATGG - Intergenic
1180427547 22:15212612-15212634 AGCATTTAAATTTCTCCAAATGG - Intergenic
1182162950 22:28141594-28141616 CTCATTAATATTTCTACTAAGGG + Intronic
950298197 3:11850156-11850178 AGCATCTTTATTTCTATCAAGGG - Intergenic
951392371 3:22122161-22122183 AGCAGTCAGATTTTTACCCAAGG - Intronic
952742025 3:36743166-36743188 AGCACTGACATTCCTACCAAAGG + Intergenic
955243066 3:57197589-57197611 AGCTATCATATTTATACCATTGG - Intergenic
956803361 3:72784260-72784282 AGCATTCATATCTTTATAAAAGG + Intronic
957542383 3:81589312-81589334 TAAATTCATATTTCTACTAAAGG + Intronic
958013110 3:87905923-87905945 TGCCTTCATTTTTCTTCCAATGG - Intergenic
959014845 3:101121936-101121958 AGCATTTAGATTTTAACCAAAGG + Intergenic
959193806 3:103150964-103150986 GTTATTCATATTTTTACCAATGG - Intergenic
961226344 3:125251775-125251797 TGCATACATATTTTCACCAAAGG - Intronic
961240236 3:125404420-125404442 AGCATTCAAATTTCTAATCAAGG + Intergenic
962243471 3:133771303-133771325 TGCATTCTTATTTCTTTCAATGG - Intronic
963204759 3:142621438-142621460 AGCATTCATATTGCTAACTAAGG - Intronic
964843318 3:161018427-161018449 AGCATAGATATTTTTACAAATGG + Intronic
965309093 3:167106380-167106402 AGAATACATATTTCTGCCTATGG - Intergenic
966280494 3:178221054-178221076 AGCAGAGATATTCCTACCAAGGG + Intergenic
966732374 3:183161939-183161961 AGCATTCATGTTACAAGCAAGGG + Intronic
970801135 4:19975165-19975187 ATGATTGATATTCCTACCAAAGG + Intergenic
970884454 4:20971098-20971120 AGCATTCATACTTCAAAGAAAGG + Intronic
971144339 4:23960721-23960743 AGCTCTCTTATTTCTACCTAAGG + Intergenic
971587263 4:28420225-28420247 AGCATTGATATTTTTAGCATTGG + Intergenic
972191286 4:36594205-36594227 AGCATTCTTTTTTCTAAGAAAGG - Intergenic
972236327 4:37138047-37138069 AGCAGTGATGTTTCTACCAGAGG + Intergenic
972804663 4:42516667-42516689 CGCCTTCATATTTCAAACAATGG + Intronic
973027185 4:45287278-45287300 TTCATCCATATTTCTACAAAGGG + Intergenic
975040143 4:69736191-69736213 GGAACTCATATTTCTACCACTGG - Intronic
981401606 4:144320549-144320571 AGCATTCATCTTTGCACCCAGGG + Intergenic
981945045 4:150331697-150331719 AGCCTTCATATTTCTTCTAAGGG + Intronic
982705104 4:158700321-158700343 TCAATACATATTTCTACCAAAGG - Intronic
982731930 4:158965046-158965068 AGCATTCATATTGCTTCTCAGGG - Intronic
983004857 4:162471944-162471966 TGCATTTTTTTTTCTACCAAGGG - Intergenic
983450835 4:167909027-167909049 AGCTTTCATATTAGTTCCAATGG + Intergenic
984600485 4:181721085-181721107 AGCATTCAGATAAATACCAAGGG + Intergenic
984798587 4:183690397-183690419 AGCTTTCATGTTTCTATCTATGG - Intronic
986106543 5:4665054-4665076 AGCATTCATCTCTATAGCAAGGG + Intergenic
986550105 5:8943820-8943842 AGCATTCATATTTTTAAGATAGG - Intergenic
988667774 5:33348790-33348812 AGCATTCCTATTTCTCCACATGG + Intergenic
994598991 5:101877777-101877799 AGCATTGATATTTCAAATAATGG - Intergenic
995346595 5:111127460-111127482 ATCATTCATATTTTTATCAAAGG - Exonic
995755006 5:115493778-115493800 AAAATTCATATTTTTCCCAAAGG + Intergenic
997098539 5:130941655-130941677 AGCATGCATTTTTCTAGCCAAGG + Intergenic
998737725 5:145161683-145161705 TGCAATCACATTTCTACCACAGG - Intergenic
1000012775 5:157248255-157248277 AGGTGTCACATTTCTACCAAGGG + Intronic
1001628161 5:173154240-173154262 AGCATTTCTATTTCTGCCAAGGG - Intronic
1003055993 6:2821051-2821073 AGCATCCATTTTTCTAGTAAGGG - Intergenic
1003283061 6:4710826-4710848 AGCATGCTTATTTCAACCACAGG - Intronic
1004211982 6:13657245-13657267 AGCATTCATATGGTTACCATGGG - Exonic
1005055442 6:21724722-21724744 AGCCTTCATATTTCTAGCTGAGG + Intergenic
1005752356 6:28895288-28895310 AGCTTTCATATTTCATTCAATGG + Intergenic
1007595503 6:43048600-43048622 AGCCTTCACATTACTAACAATGG - Intronic
1008228187 6:48949388-48949410 AGTATTTTTATTTCTGCCAAAGG - Intergenic
1008715664 6:54286605-54286627 AGAATTCATATTTTTACTTAAGG - Intergenic
1009812350 6:68684614-68684636 TGCACTCATTTTTCTCCCAATGG - Intronic
1010099409 6:72086237-72086259 ATAATTCATATTTCTTCCAAAGG + Intronic
1010296870 6:74208712-74208734 GGCATCCACATATCTACCAATGG + Intergenic
1011018683 6:82786964-82786986 AGCAAATATACTTCTACCAAGGG + Intergenic
1012618704 6:101312346-101312368 TGCATTCACATTTCTATTAAAGG + Intergenic
1012677958 6:102140740-102140762 AACATTCAAATTTCTACCTAAGG - Intergenic
1013526502 6:110979377-110979399 AGCATTGTTCTATCTACCAAAGG - Intergenic
1014010228 6:116467105-116467127 AGCATTGATATTTCTAGCCATGG - Intergenic
1015138538 6:129902523-129902545 AACATCCATATTTCTACCAATGG + Intergenic
1016360004 6:143257526-143257548 AGCATTTATATTTTTACAGAAGG + Intronic
1018095266 6:160381727-160381749 AGCCATGATTTTTCTACCAATGG + Intronic
1018111093 6:160537515-160537537 AGCATTCATATTGCTTCCCCAGG - Intronic
1018124784 6:160671090-160671112 AGCATTCATATTGCTTCCTCAGG - Intergenic
1018206752 6:161443739-161443761 AGCACACTTGTTTCTACCAAAGG - Intronic
1018453560 6:163931336-163931358 AGCATTCCTATTTCTCCACAAGG + Intergenic
1019828891 7:3306097-3306119 AGCAATCAGATCTGTACCAAAGG + Intronic
1020614206 7:10438253-10438275 AGCAGTGATATTTCTTCCAGGGG - Intergenic
1021897791 7:25253559-25253581 AGCATCCATATTTCTATCAATGG - Intergenic
1025713802 7:63934758-63934780 AGCAATCATGTTTCTCTCAAGGG - Intergenic
1030125536 7:106149505-106149527 AGAATTCATCTTTCCTCCAAGGG + Intergenic
1032539712 7:132693032-132693054 AGTATTCATCTTTCTCCTAAAGG - Intronic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1036002974 8:4629869-4629891 AGCATTCAGATTTACACAAAGGG - Intronic
1036029544 8:4952989-4953011 TGCATTCATACTTATACTAAAGG + Intronic
1038386350 8:27151142-27151164 AACAATCATATTTCTAATAAGGG + Intergenic
1038508442 8:28106925-28106947 AGCACTAAAATATCTACCAATGG - Intronic
1039205983 8:35155274-35155296 TGAATTCATTTTTCTAACAAAGG + Intergenic
1041142390 8:54836475-54836497 AGCAAACATTTTTCTCCCAATGG + Intergenic
1041688815 8:60669453-60669475 ACCATGCATATTTTGACCAAGGG + Intergenic
1043039782 8:75248278-75248300 AACATCCATATTTCTACTAATGG - Intergenic
1043134803 8:76507797-76507819 ATTATTCAAATTTCTATCAAAGG - Intergenic
1043199883 8:77353577-77353599 AGGATTCAAACTTCTACCCAAGG + Intergenic
1043300325 8:78722063-78722085 ATTATGCTTATTTCTACCAAAGG + Intronic
1043659329 8:82716411-82716433 AAAATGCAAATTTCTACCAATGG + Intergenic
1045135776 8:99216137-99216159 GGCATTCAAATTTTTCCCAAGGG - Intronic
1046261975 8:111780484-111780506 AGCATTCAGATTTGTACCCATGG + Intergenic
1047204969 8:122795697-122795719 AGTATAAAAATTTCTACCAATGG - Intronic
1047703374 8:127472821-127472843 AGCATTTTTTTTTCTATCAAGGG - Intergenic
1047872331 8:129097768-129097790 ACTATCCATATTTCCACCAAAGG - Intergenic
1048396313 8:134017379-134017401 AACATTCATATTTTATCCAAAGG - Intergenic
1050765460 9:9127663-9127685 AGCTTTCATATTTGAGCCAAAGG + Intronic
1050792155 9:9486370-9486392 AGTATTCTTATTGCTTCCAATGG + Intronic
1050993299 9:12180103-12180125 AGCATTCATATTTTTATTATTGG - Intergenic
1051327174 9:15985026-15985048 ATTATTCATAATTCTACCACTGG - Intronic
1053685982 9:40523233-40523255 AGCATTTAAATTTCTCCAAATGG + Intergenic
1053711398 9:40813266-40813288 AGCATTTAAATTTCTCCAAATGG + Intergenic
1053935936 9:43151506-43151528 AGCATTTAAATTTCTCCAAATGG + Intergenic
1054277751 9:63101736-63101758 AGCATTTAAATTTCTCCAAATGG - Intergenic
1054299064 9:63358686-63358708 AGCATTTAAATTTCTCCAAATGG + Intergenic
1054397085 9:64663194-64663216 AGCATTTAAATTTCTCCAAATGG + Intergenic
1054421311 9:64934083-64934105 AGCATTTAAATTTCTCCAAATGG + Intergenic
1054431727 9:65168386-65168408 AGCATTTAAATTTCTCCAAATGG + Intergenic
1054498651 9:65853121-65853143 AGCATTTAAATTTCTCCAAATGG - Intergenic
1055064618 9:72105983-72106005 AGAATACATATTTGTACCAGAGG - Intergenic
1055587897 9:77775263-77775285 AGCAATAACATTTCTACCAGTGG + Intronic
1055883893 9:81035963-81035985 AAAATTCATATTTTTATCAAGGG - Intergenic
1061527674 9:131180562-131180584 AGCTTACATATTTCTGCCATTGG + Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1188511193 X:30938076-30938098 AGGGTACATCTTTCTACCAAGGG + Intronic
1194029717 X:88797253-88797275 AGCATCCATAGTTCTGCAAAAGG - Intergenic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1196199019 X:112864584-112864606 GACATTCAGATTTCTACTAATGG - Intergenic
1196548446 X:116993529-116993551 AAAATAAATATTTCTACCAATGG + Intergenic
1197145606 X:123168931-123168953 AGCATTCATTTTTCAACAGAAGG + Intergenic
1198719476 X:139600410-139600432 AACATCCATTTTTCTGCCAAAGG - Intronic