ID: 1195176363

View in Genome Browser
Species Human (GRCh38)
Location X:102318616-102318638
Sequence CGGGGGCAGAGAGGTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 3, 1: 0, 2: 1, 3: 28, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195176357_1195176363 12 Left 1195176357 X:102318581-102318603 CCAGGTAAGGCTGACAGCAGCAA 0: 3
1: 1
2: 0
3: 15
4: 143
Right 1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG 0: 3
1: 0
2: 1
3: 28
4: 298
1195176356_1195176363 13 Left 1195176356 X:102318580-102318602 CCCAGGTAAGGCTGACAGCAGCA 0: 3
1: 1
2: 1
3: 17
4: 199
Right 1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG 0: 3
1: 0
2: 1
3: 28
4: 298
1195176355_1195176363 22 Left 1195176355 X:102318571-102318593 CCGCTTTGACCCAGGTAAGGCTG 0: 3
1: 1
2: 1
3: 10
4: 106
Right 1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG 0: 3
1: 0
2: 1
3: 28
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195176363 Original CRISPR CGGGGGCAGAGAGGTCTGCC TGG Intronic
900370215 1:2328910-2328932 CGGGTGCAGAGGGGCCTCCCTGG - Intronic
900680936 1:3915789-3915811 CGGTGGCAGAGAGAACTTCCTGG + Intergenic
900731822 1:4267135-4267157 TGGGGGCAGAGTGGGCTGCCAGG + Intergenic
901173332 1:7280043-7280065 AGAGGGCTGAGAGGTCTGTCTGG - Intronic
901535969 1:9883213-9883235 CTCGGGCAGAGTGGTCTCCCAGG + Intronic
902370896 1:16006203-16006225 TGGGGGCAGAGCGGGCTGACTGG - Exonic
902409150 1:16202584-16202606 CGGGGGAGGGGAGGTCAGCCTGG + Intronic
903275593 1:22219359-22219381 TGGAGGCAGAGAGATCTGCTGGG - Intergenic
903888525 1:26555065-26555087 CTGGGGCAGAGGGGTCTGACTGG + Intronic
903950561 1:26993872-26993894 CGGGGGCTGAGAGGACGGCATGG - Exonic
904293195 1:29500826-29500848 CAGGGGCAGAGAGGCCTGCAGGG - Intergenic
904424543 1:30414981-30415003 TGAGGTCAGAGAGGTCGGCCAGG - Intergenic
912470640 1:109904619-109904641 GAGGGGCAGAGCGCTCTGCCTGG + Intergenic
913437213 1:118859581-118859603 TGGGGGCAGGGAGTTCTGCAGGG - Intergenic
913531701 1:119738324-119738346 AGGGGGCAGAGAGGCCTGGAGGG - Intronic
913532437 1:119742576-119742598 GGAGGGCAAAGAGATCTGCCAGG - Intronic
914013228 1:143794754-143794776 AGGGGGCAGAGAGAGCTCCCTGG + Intergenic
914164598 1:145166431-145166453 AGGGGGCAGAGAGAGCTCCCTGG - Intergenic
914651850 1:149703363-149703385 AGGGGGCAGAGAGAGCTCCCTGG + Exonic
914985999 1:152457675-152457697 CGAGGGCAGAGAAGTTTGCTGGG + Intergenic
920383748 1:205552321-205552343 GGGAGGGAGAGAGGGCTGCCAGG + Intergenic
920566704 1:206979955-206979977 CTGGGATAGAGAGATCTGCCAGG - Intergenic
922245732 1:223795815-223795837 AGGAGGCAGAGAGACCTGCCCGG + Exonic
923340883 1:233006008-233006030 CAGGGGCAGAGAGGGCAGGCAGG + Intronic
923674076 1:236065153-236065175 CGGGAGGAGAGGGGGCTGCCAGG - Exonic
924235781 1:241998579-241998601 CGGGGGCAGGAACGTCTCCCTGG + Exonic
1062896693 10:1108783-1108805 CTGGGGCAGGGAGCTGTGCCAGG - Intronic
1062966185 10:1609414-1609436 CAGGGGCAGACAGGGCTGGCAGG - Intronic
1063436597 10:6037034-6037056 AGGGGGCAGAGAGAGCAGCCGGG - Intronic
1063965058 10:11340197-11340219 TGCGGGGAGAGAGGTTTGCCTGG - Intergenic
1064231041 10:13529208-13529230 CGGGGGCAGGCAGGCCGGCCGGG - Intergenic
1064992689 10:21269827-21269849 AGGTGGCAGAGAGCTGTGCCTGG - Intergenic
1065034280 10:21621660-21621682 CAGGGGCAGGGAGGTCTACTGGG + Intronic
1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG + Intergenic
1066446417 10:35487828-35487850 TGGGGGTAGAGAAGTTTGCCAGG + Intronic
1069589824 10:69634834-69634856 CGGGAGGAGAGAGGCCTGCCTGG + Intergenic
1069933495 10:71899650-71899672 CCAGGGCAGTGAGGTCTCCCAGG + Intergenic
1070519260 10:77237762-77237784 CTGGGGCAAAAAGGTCTGCTGGG - Intronic
1070793417 10:79203133-79203155 AGGGGGCTGTGAGTTCTGCCTGG - Intronic
1072788390 10:98300380-98300402 CGGGGGCAAAGTGGTCTTTCTGG + Intergenic
1073404638 10:103286536-103286558 TGGAGGCAGAGAGGTCTTCCTGG + Intronic
1075415505 10:122259333-122259355 CGGGGACAGAAAGAACTGCCTGG + Intergenic
1075680147 10:124325704-124325726 CATGGTCAGAGAGGGCTGCCTGG - Intergenic
1076543711 10:131230166-131230188 AGGGGGCAGAGACGTCCCCCAGG + Intronic
1076680025 10:132167101-132167123 CAGGGGCAGAGGAGTCTTCCGGG - Intronic
1076680963 10:132170948-132170970 CTGGGGCTGACAGCTCTGCCTGG - Intronic
1077126500 11:941065-941087 TGGGGGCCGAGGGGCCTGCCTGG + Intronic
1077145016 11:1040843-1040865 TGGGGTCAGAGGGGTCTGCAGGG - Intergenic
1077488667 11:2850593-2850615 CTCTCGCAGAGAGGTCTGCCGGG - Intergenic
1077505575 11:2928682-2928704 CTGGGTCAGAGAGCTGTGCCAGG + Intronic
1078354589 11:10624532-10624554 CAGGGGCAAGGAGCTCTGCCAGG - Intronic
1079106377 11:17574889-17574911 GGGGGACACAGAGGTCAGCCTGG - Exonic
1080749441 11:35139004-35139026 CGGGGGCAGAGGGGCCCGCCCGG + Intronic
1081809224 11:45905931-45905953 GGAGGGCAGAGTGGGCTGCCTGG + Exonic
1082784806 11:57311114-57311136 TGAGGGCTGAGAGGTCTTCCTGG - Intronic
1082952348 11:58830920-58830942 GGGAGGCAGAGGGGTCTTCCTGG - Intergenic
1084566411 11:69931318-69931340 CTGGGACAGAGATGCCTGCCAGG + Intergenic
1084575507 11:69985842-69985864 GGGGGGTGGGGAGGTCTGCCCGG + Intergenic
1085423096 11:76380717-76380739 CGGGCGCAGAGCGGGCGGCCCGG - Intronic
1085453619 11:76653900-76653922 TGGGAGTAGAGGGGTCTGCCTGG - Intergenic
1085533194 11:77203562-77203584 AGGGGGCAGAGAGGACTTCCTGG + Intronic
1088607997 11:111549642-111549664 CTGCGGCAGCGAGGTCTGCGTGG + Exonic
1089238924 11:117057685-117057707 CGTGGGCACTGGGGTCTGCCCGG + Intronic
1089363105 11:117903958-117903980 TGGGGGCAGAGACTCCTGCCAGG - Exonic
1089632212 11:119790969-119790991 AGGAGGGAGAGAGGGCTGCCTGG + Intergenic
1089673440 11:120073081-120073103 GGGGGTCAGGGAGGTCTCCCAGG + Intergenic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1090226311 11:125074158-125074180 CTGGGGCAGGGAGGACTGCCAGG - Intronic
1095983308 12:47984650-47984672 TGGGGGCAGAGCGGGCTGCAGGG + Intronic
1096547026 12:52347144-52347166 CAGAGGCAGAGAGGTGGGCCAGG + Intergenic
1096584836 12:52613375-52613397 TGGAGGCAGAGAGTTCTGTCTGG - Intronic
1097106806 12:56630483-56630505 CGGGTGCAGAGGGAGCTGCCAGG - Intronic
1097156588 12:57016406-57016428 CGGGGGCTGGGTGGTCTGGCAGG + Exonic
1098139783 12:67439788-67439810 CAGAGGCAGAGAGGTCTTTCTGG - Intergenic
1099701111 12:86083279-86083301 CAGGGGCAGAGAGATCAGCTAGG - Intronic
1102506017 12:113384977-113384999 TCGGGGCAGAGGGGACTGCCAGG + Intronic
1102572484 12:113835539-113835561 CGGGGTCAGTGGGGGCTGCCGGG + Intronic
1103488275 12:121296999-121297021 CGGGGGAAGAGAGGCCCGGCCGG + Intronic
1104889696 12:132134404-132134426 TGGGGGCTGAGGGGTGTGCCGGG - Intergenic
1105719639 13:23100971-23100993 CGGGGACAGAGAGGTATGTTAGG - Intergenic
1105814275 13:24019940-24019962 TGGGGGCAAAGAGGTGTGGCTGG - Intronic
1106666984 13:31861964-31861986 CTGAAGCAGAGAGGGCTGCCAGG + Intergenic
1112017101 13:95340355-95340377 CTGGGGCAGGGAGGTTTGGCAGG + Intergenic
1117860953 14:60092141-60092163 CCGGGGCAGCGAGGCCAGCCAGG + Exonic
1118438481 14:65792163-65792185 CTGGGGCAGAGAGGCCTCCCAGG - Intergenic
1119477668 14:74940417-74940439 CAGGGGCACAGGGGCCTGCCTGG - Intergenic
1121020707 14:90578545-90578567 AGGGAGCAGTGAGGCCTGCCTGG + Intronic
1121277741 14:92679279-92679301 CGTGGTCAGACAGGGCTGCCAGG - Intronic
1121334078 14:93066342-93066364 AGGGGGCAGAGGCGTCTGCTGGG + Intronic
1122071830 14:99209947-99209969 GGGGGGCTCAGAGGTCTTCCTGG - Intronic
1122244836 14:100395049-100395071 CGGGGACAGTGAGGACGGCCAGG + Intronic
1122417627 14:101557962-101557984 CTGGGGCAGTGAGGTCCGGCGGG + Intergenic
1122753931 14:103962123-103962145 AGAGGGCAGAGAAGTGTGCCTGG + Intronic
1122789135 14:104177006-104177028 TGGGGACAGAGTGGTCAGCCCGG - Exonic
1122978601 14:105181227-105181249 CGGGGGCCGCGAGCTCTGCGGGG + Exonic
1123676424 15:22714563-22714585 GGGCGGGAGAGAGGGCTGCCGGG + Intergenic
1124328639 15:28788824-28788846 GGGCGGGAGAGAGGGCTGCCGGG + Intergenic
1124410493 15:29432714-29432736 CTGGGACAGAGGTGTCTGCCAGG - Intronic
1126050391 15:44679942-44679964 TGGAGACAGAGAGGGCTGCCTGG + Intronic
1127447901 15:59084233-59084255 AGGCTCCAGAGAGGTCTGCCTGG + Exonic
1127880930 15:63157779-63157801 CGGGGGCTGAGCGGCCCGCCGGG - Exonic
1128495688 15:68197227-68197249 AGGGCGCAGGGAGGTCTGCCAGG - Intronic
1129740002 15:77985508-77985530 CAGGGCCAGAGAGGGCTGGCTGG + Intronic
1129741940 15:77993539-77993561 TGGGGGCAGGAAGGTCTTCCGGG + Intronic
1129843767 15:78758932-78758954 TGGGGGCAGGAAGGTCTTCCGGG - Intergenic
1132521096 16:389526-389548 CAGGGACAGAGATGGCTGCCGGG + Intergenic
1132844293 16:1992830-1992852 CGGGGTCAGCGGGGTCAGCCGGG - Intronic
1132865033 16:2089086-2089108 TGGGGGCACAGCTGTCTGCCAGG - Exonic
1132934304 16:2473213-2473235 GAGGGGCAGAGAGATCTGCAGGG - Intronic
1135055921 16:19232038-19232060 GGGATGCAGAGAGGTCGGCCGGG + Intronic
1136274209 16:29168745-29168767 GGAGGACAGAGAGGTCTGCGTGG + Intergenic
1136418270 16:30116644-30116666 AGGGTGCAGAGATGTCTGTCTGG + Exonic
1138514875 16:57530519-57530541 AGGGGACATAGAGGGCTGCCAGG - Intronic
1139475668 16:67201451-67201473 GAGGGGCAGAGAGGTCCCCCTGG - Intronic
1139489302 16:67278180-67278202 GGTGGGAAGAGAGGTCTGGCTGG + Exonic
1139948201 16:70656168-70656190 CCTGTGCAGAGAGGTGTGCCTGG - Intronic
1140481633 16:75265637-75265659 CGGGGGCAGAGAGGCCGGCTTGG + Intronic
1141031672 16:80594555-80594577 AGGGTGCAGAGAGGAGTGCCTGG - Intergenic
1141350030 16:83286233-83286255 ATCGTGCAGAGAGGTCTGCCTGG - Intronic
1141435655 16:83998347-83998369 TGGTGGCAGGGAGCTCTGCCTGG + Intronic
1141696728 16:85623784-85623806 CGGGGGCAGAAAGGGCCACCTGG - Intronic
1142105235 16:88299076-88299098 GGGGGGCAGGGAGGGCTTCCTGG + Intergenic
1142218105 16:88839714-88839736 CTGGGGCTCTGAGGTCTGCCTGG + Intronic
1142354766 16:89597167-89597189 CGGGGTCTGCGGGGTCTGCCTGG + Exonic
1142805548 17:2369475-2369497 CGGGGGGAGGGGGGTCTGCTGGG - Intronic
1143011641 17:3869388-3869410 TGGGGGGACAGAGGCCTGCCTGG - Intronic
1143096811 17:4482721-4482743 GGGAGGCAGGGAGCTCTGCCTGG - Intronic
1144668594 17:17118630-17118652 AGGGGGAAGGGAGTTCTGCCTGG + Intronic
1144833594 17:18144986-18145008 CAGGGCCAGAGAGGGCTTCCTGG + Intronic
1146058833 17:29593978-29594000 CCGGGGCAGTGAGGGCTGCAGGG + Intronic
1146467207 17:33095726-33095748 CAGGGGCAGCAAAGTCTGCCTGG + Intronic
1146726996 17:35164471-35164493 AGGCTGCAGAGAGGTCTGCAGGG - Intronic
1146928532 17:36761888-36761910 CGGGGCCTGAGAGGTCTCCTGGG - Intergenic
1147419331 17:40314381-40314403 TGGGGGCAGGGAGTGCTGCCAGG + Intronic
1147581098 17:41627548-41627570 CGGGGCCAGAGAGATGTGTCAGG - Intergenic
1148180322 17:45600637-45600659 GGAGGGCAGAGTGGGCTGCCTGG - Intergenic
1148268578 17:46245257-46245279 GGAGGGCAGAGTGGGCTGCCTGG + Intergenic
1148440473 17:47709228-47709250 CGCGGGCTGAGGGGCCTGCCAGG - Exonic
1149598233 17:57876428-57876450 CGGGGGCAGGGAAGGCTGCCAGG - Intronic
1149958850 17:61084470-61084492 CGGGGTCAGAGCGGACTGGCTGG - Exonic
1151346992 17:73508280-73508302 GCGGGGCAGGGAGGTCTGCGAGG - Intronic
1152434013 17:80264278-80264300 CAGGGGTTGAGAGCTCTGCCTGG + Intronic
1152531191 17:80920191-80920213 CGCAGGCAGGCAGGTCTGCCAGG + Intronic
1152569089 17:81113613-81113635 CGGGGGCAGGGGGGTCGGCGGGG - Intronic
1152695334 17:81741209-81741231 CGGGGGCAGCAAGGTCTGATGGG - Intergenic
1152739748 17:82013692-82013714 CAGGGCCACAGAGGGCTGCCGGG - Intronic
1153253082 18:3142022-3142044 CAGTGACAGAGAGGTCTGTCGGG + Exonic
1157381851 18:47225795-47225817 AGGGGTGAGAGTGGTCTGCCAGG + Intronic
1158616468 18:58992333-58992355 CGGGAGCAGGGAGGTCTTCCGGG - Intergenic
1160761713 19:788846-788868 CGGGGGCACAGAGGGATGGCAGG - Intergenic
1160808207 19:1001629-1001651 CTGGGGCATAGAGCTCAGCCAGG - Intronic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1160959897 19:1715778-1715800 CAGGAGCAGAGAGCTCTGTCTGG + Intergenic
1161143661 19:2664348-2664370 AGGGGGCAGAGAGGCCTGGACGG + Intronic
1161209431 19:3058531-3058553 AGGGAGCTGAGGGGTCTGCCTGG - Intronic
1161270043 19:3384806-3384828 TGGGGGCAGAGAGGTGGGCCGGG + Intronic
1161563545 19:4986831-4986853 CAGGAGCAGAGAGGACTGCAGGG + Intronic
1161925192 19:7294326-7294348 CGGCGGGAGAGAGGGCTGCTCGG + Intergenic
1162706092 19:12555727-12555749 CTGGGACAGAGAGGTCCCCCAGG - Intronic
1163254089 19:16144328-16144350 TGGGGACAGAGAGGGGTGCCAGG + Intronic
1163420977 19:17213481-17213503 GGAGGCCAGAGAGGGCTGCCAGG - Intronic
1163426387 19:17243183-17243205 GGAGGTCAGAGAGGGCTGCCTGG - Intronic
1163843191 19:19624088-19624110 CCTGGGCAGAGTGGTGTGCCTGG + Exonic
1164681006 19:30133746-30133768 AGGGTGCAGAGAGGTATGCTGGG + Intergenic
1165113287 19:33514255-33514277 TGCGAGCAGAGAGCTCTGCCTGG + Intronic
1165850888 19:38849798-38849820 CGGCGGCAGTGAGGGCGGCCGGG - Exonic
1166391838 19:42412750-42412772 TGGGGACAGAGAGGGCAGCCTGG - Intronic
1166997660 19:46727502-46727524 CGGGGGCGGGGAGGTGAGCCTGG - Exonic
930800408 2:55437878-55437900 AGGGGGAAGGGAGGTCTTCCTGG - Intergenic
930869132 2:56152069-56152091 CTGGAGTAGAGAGGTGTGCCAGG + Intergenic
932398570 2:71464596-71464618 GGAGGTCAGAGAGGTCAGCCAGG + Intronic
932424605 2:71621046-71621068 CGGGTGCTAAGAGGTCTGCTGGG + Intronic
932569671 2:72931933-72931955 GTGGGACAGAGAGGACTGCCTGG + Intronic
932664225 2:73684073-73684095 ATGGTGCAGAGAGGTCTGGCAGG - Intergenic
934133014 2:88967831-88967853 CTTGGGCAGAGAACTCTGCCTGG + Intergenic
934930745 2:98420729-98420751 AGGGGTCAGAGATGTCTGACAGG + Intergenic
942045100 2:172095405-172095427 CGAGGGAAGAAAGGTCTGTCTGG + Intergenic
945049169 2:205807041-205807063 CGGGGGTAGTGGGGTCTCCCTGG + Intergenic
946023409 2:216657230-216657252 TGGGGACAGAGAGGCCTGTCTGG + Intronic
947591428 2:231388334-231388356 CACGGGCAGAGAGATCTGGCGGG + Intergenic
948719927 2:239893100-239893122 GAGGGGCAGAGAGTACTGCCAGG - Intronic
949075672 2:242055867-242055889 CATGGGGACAGAGGTCTGCCTGG - Intergenic
1168795985 20:610374-610396 CGGGGGCGGAGGGCTCCGCCCGG + Exonic
1168973523 20:1947265-1947287 CGGGGGCAGGGAGAGCTGCAAGG + Intergenic
1169144727 20:3244868-3244890 GGAGGGCAGAGAGGCCTGACAGG - Intergenic
1169452955 20:5727929-5727951 CTGGGGCAGAGATATCTGCTTGG - Intergenic
1170889908 20:20368192-20368214 CGGGGGCACTGAGGGCCGCCGGG + Exonic
1171471915 20:25379023-25379045 TGGGGGCCGAGAGTTCTGCCTGG + Intronic
1171868618 20:30508666-30508688 CTGAGGCAGAGACGTCTGGCAGG + Intergenic
1172437706 20:34941868-34941890 CATGGGCAGAGGGGTCTTCCAGG - Intronic
1173125211 20:40330218-40330240 GGGGAGCTGAGAGATCTGCCAGG + Intergenic
1174579564 20:51562315-51562337 CGGGGGCAGGGAAGTGTCCCAGG - Intronic
1175333871 20:58182421-58182443 CGGGGGCACTCAGGTCTGTCTGG - Intergenic
1175418285 20:58815955-58815977 TGGGGGCAGTGAGGGCTGCAGGG + Intergenic
1175758408 20:61544786-61544808 CGGGGGCAGGGAGGGCTGTCGGG - Intronic
1175952110 20:62589043-62589065 GGGGAGCTGAGAGCTCTGCCGGG - Intergenic
1176023620 20:62974895-62974917 CGGGGGCAGAGAAGAGTGCTTGG - Intergenic
1178561564 21:33643077-33643099 CGAGGGCAGCGAGGTCAGCCCGG - Intronic
1178900361 21:36593254-36593276 CGGGGGCAGAGGGCTCTCCAGGG - Intergenic
1179818898 21:43925128-43925150 CGAGGGGAGAGAGTCCTGCCAGG - Exonic
1179887162 21:44319085-44319107 CTGGGGCAGAGTGCCCTGCCTGG + Intronic
1180830528 22:18903726-18903748 CGGGGTCTGCCAGGTCTGCCAGG - Intergenic
1181148738 22:20867392-20867414 CTGGGGCACAGGTGTCTGCCTGG + Intronic
1181732232 22:24855584-24855606 CGCGGGCAGAGAGGGATGGCCGG - Exonic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1183441966 22:37828255-37828277 CTGGAGCAGAGAGGTCAGTCAGG + Intergenic
1183467048 22:37985048-37985070 ATGGGGCAGAAAGGGCTGCCTGG - Intronic
1183508396 22:38221696-38221718 TGGGGGCACAGCGGCCTGCCGGG + Exonic
1183640934 22:39091954-39091976 TCAGGGGAGAGAGGTCTGCCGGG + Intergenic
1183642505 22:39101120-39101142 GGGGGGCAGAGGGGTCTGTCCGG - Intronic
1183696963 22:39428929-39428951 CGGGGCTAGAAAGGCCTGCCAGG + Intronic
1184104537 22:42359823-42359845 CAGGGGAAGAGAAGTCTGCCAGG - Intergenic
1184152386 22:42646533-42646555 GGTGGGCAGAGAGAGCTGCCAGG + Intronic
1184260155 22:43310306-43310328 GGGGGTAACAGAGGTCTGCCCGG - Intronic
1184436144 22:44478537-44478559 TGGGGTCAGGGATGTCTGCCAGG + Intergenic
1184872488 22:47249718-47249740 AGAGGGCAGAGAGGGCTTCCTGG + Intergenic
1185236876 22:49718978-49719000 GGGGGACAGAAAGGTCTCCCAGG - Intergenic
1185366483 22:50439224-50439246 CGGGGGCAGAGATCTCTGTTAGG + Intronic
1203280618 22_KI270734v1_random:128997-129019 CGGGGTCTGCCAGGTCTGCCAGG - Intergenic
950282522 3:11719852-11719874 CTGGGGCAGTGAGGTTTGTCGGG + Intronic
950978838 3:17280187-17280209 TGGGGGCAGGGAGGTCTGCAGGG + Intronic
952593553 3:34988198-34988220 CGAGGGCTGTGAGGACTGCCAGG - Intergenic
953200219 3:40771811-40771833 AGGGGGCCGAGAGGTCAGACTGG - Intergenic
954157376 3:48694013-48694035 CTGGGGCAGAGAGGCCTGGGAGG - Intronic
954613523 3:51958282-51958304 AGGGGGCAGGCAGGTCTGCGGGG + Exonic
956334377 3:68146739-68146761 CTGAGGTTGAGAGGTCTGCCAGG + Intronic
956681358 3:71784925-71784947 CAGGGGCAGACAGGTGCGCCCGG + Intronic
961152209 3:124648471-124648493 CGTGGGCAGAGGTGTCTCCCTGG + Intronic
961779577 3:129313837-129313859 AGGCGGCAGAGAGGTCTGCCAGG + Intergenic
965071896 3:163925078-163925100 CGTGAGCTGAGAGATCTGCCAGG + Intergenic
967045400 3:185732114-185732136 CGGGGGCAGAGAGGAGAGGCTGG - Intronic
967723724 3:192842124-192842146 CAGAGGCAGAGAGGTCAACCAGG + Intronic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968135391 3:196216619-196216641 CGGGGGCAGGGTGGCTTGCCTGG - Exonic
968549882 4:1216741-1216763 TGGGGGCAGGCACGTCTGCCTGG - Intronic
968894635 4:3391800-3391822 GGGCGTCAGAGAGGGCTGCCTGG + Intronic
969506585 4:7591764-7591786 CGGGGTCAGAGGCCTCTGCCGGG - Intronic
970423881 4:15929108-15929130 CTGGAGCAGAGGAGTCTGCCGGG - Intergenic
970878523 4:20900600-20900622 CAGGGACAGAAAGGTTTGCCAGG - Intronic
973780880 4:54287422-54287444 CACGGGCAGAAAGGTCTGCAAGG - Exonic
975493733 4:75015409-75015431 CTGGGGAAGAGAGGTGTGGCCGG + Intronic
982871961 4:160591212-160591234 CGTGGAGAGAGAGGTCTGCTTGG + Intergenic
985107873 4:186516375-186516397 CGGTGGCAGACAGATCTGCATGG + Intronic
985997238 5:3603664-3603686 CAGGGGCAGAGAACTCTACCTGG - Intergenic
987970565 5:24938872-24938894 CAGGGGCAGAGGGGTATGCCAGG - Intergenic
988225208 5:28404478-28404500 CGGGGGTAGAGGGGTCTTCCCGG - Intergenic
990998613 5:61758944-61758966 CCTGGGCAGAGAGAACTGCCTGG + Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992716273 5:79514123-79514145 CGGCGGCAGAGTGGGCTGCGGGG + Exonic
996099853 5:119435240-119435262 CAAGGGCAGAGAGGTGTGTCAGG + Intergenic
997691548 5:135830854-135830876 CGGTGGCAGATAGGTCAGACGGG + Intergenic
999298035 5:150472776-150472798 GGGAAGCAGAGAGGCCTGCCAGG - Intergenic
1001412101 5:171519227-171519249 CGGAGGCAGAGAGGGCAGACAGG + Intergenic
1001644641 5:173271118-173271140 AGGGGGCAGACACGTCTGCAAGG + Intergenic
1002174997 5:177396725-177396747 AGGGGGCAGGGAAGTCTGCAAGG - Exonic
1002437262 5:179239163-179239185 GGGAGGCAGGGAGGTCTGCTGGG + Intronic
1002678103 5:180935587-180935609 CAGGGGCAGAGAGGGTTTCCAGG + Intronic
1004140522 6:13013702-13013724 CTGGGGCAGCGAGGTCGGCGAGG + Intronic
1006171744 6:32097126-32097148 CGGGGCCTGAGAAGCCTGCCCGG + Intronic
1006378619 6:33685130-33685152 CTGGGGCAGAGGGGTATGCGGGG + Intronic
1006398336 6:33801565-33801587 CTGGGGCAGGGAGGTCTCTCTGG - Intronic
1006789867 6:36693003-36693025 CGGGTGCTGAGAGCTCAGCCTGG - Intergenic
1007754553 6:44090455-44090477 AGTGGGCAGAGGGGACTGCCAGG + Intergenic
1007827632 6:44612700-44612722 CATGAGCAGAGAGCTCTGCCTGG + Intergenic
1008527319 6:52419959-52419981 GGGGCGCAGTGAGGTCCGCCAGG + Intergenic
1011945136 6:92890958-92890980 TGGGGTCAGAAAGGTCAGCCTGG + Intergenic
1015538903 6:134295269-134295291 AGGGGGCAGAGAGCTGAGCCAGG + Intronic
1018316637 6:162562753-162562775 TCAGGGCAGTGAGGTCTGCCAGG - Intronic
1018457958 6:163969721-163969743 GGGGTGCAGACAGGTCTGCAGGG - Intergenic
1018899680 6:168044717-168044739 CGGCTGCAGAGAGGGCCGCCCGG - Intronic
1019176626 6:170162515-170162537 CGGGAGCAGAACGGGCTGCCAGG - Intergenic
1019545144 7:1570531-1570553 CAGGTGCAGAGAGCTCGGCCAGG + Intronic
1019554589 7:1622599-1622621 TGAGGGCAGAGAGGTCTCACGGG - Intergenic
1022466464 7:30655837-30655859 CTGGGGCAGAGGGCTCTGCCAGG + Intronic
1022662899 7:32382871-32382893 CAGGGTGGGAGAGGTCTGCCTGG - Intergenic
1023700127 7:42883928-42883950 TGGGGGCAGGGAGGCCTTCCTGG + Intergenic
1024420987 7:49166460-49166482 CTGGGGCAGAGAGCTCTGACAGG - Intergenic
1026732376 7:72923366-72923388 CTGGAGCTGAGAGGTCTGGCAGG - Intronic
1027111602 7:75443998-75444020 CTGGAGCTGAGAGGTCTGGCAGG + Intronic
1027283833 7:76628532-76628554 CTGGAGCTGAGAGGTCTGGCAGG + Intergenic
1028603719 7:92631259-92631281 CTGGGACAGAGAGGTTTCCCAGG - Intronic
1030523730 7:110629272-110629294 TGGGGGCAGGGAGGTCAGACAGG - Intergenic
1032095287 7:128935169-128935191 TGGGGACAGGGAGGTCTGTCCGG - Intergenic
1032312868 7:130804349-130804371 CTGGGGGAGAGAGGGCAGCCAGG + Intergenic
1032313903 7:130815923-130815945 CTGGTGCAGAGAGGGCTTCCAGG + Intergenic
1032983586 7:137313112-137313134 CGTGGGGAGTGAGGGCTGCCAGG - Intronic
1034026748 7:147712917-147712939 GGTGGGCAGAGAGGACTGACAGG - Intronic
1034284295 7:149874188-149874210 CCGGGGTGGAGAGGTCTGCAGGG - Intronic
1035020783 7:155798942-155798964 CGGAGGCAGCCACGTCTGCCTGG - Intergenic
1035911181 8:3567744-3567766 AGGGGGCAGAGAGGTCTCAGAGG - Intronic
1036478985 8:9120936-9120958 AGGGGGCAGAGAGGTGTTCAGGG - Intergenic
1036788963 8:11705056-11705078 CGTGGGCAGAGGGGGGTGCCGGG + Intronic
1037770303 8:21795044-21795066 GGGCTGCAGAGAGGTCTGCGAGG - Intronic
1041509771 8:58643451-58643473 TGGGGGCAGGGAGGTATGACAGG - Intronic
1043183011 8:77108680-77108702 CAGGGGCAGGGGGGCCTGCCAGG + Intergenic
1044838998 8:96322220-96322242 AGGGACCAGAGAGGGCTGCCTGG - Intronic
1045315731 8:101041889-101041911 GGGGGGCAGAGGGGTCAGCCAGG + Intergenic
1046621137 8:116530923-116530945 CGAGGGCTGTGAGGACTGCCAGG - Intergenic
1049243443 8:141550079-141550101 TGGGGGCAGTGACGCCTGCCGGG - Intergenic
1049416749 8:142498912-142498934 CAGTGGCACAGAGGTCTGGCAGG - Intronic
1049473224 8:142785482-142785504 GGGGGGCAGAGGTGGCTGCCTGG - Intronic
1049591575 8:143465252-143465274 CTGGGGCAGAGGGGTGGGCCAGG - Intronic
1049640381 8:143712546-143712568 GGGGTGCAGGGAGGCCTGCCAGG - Intronic
1049757308 8:144316413-144316435 TAGGGGCAGAGAGGCCTCCCTGG + Exonic
1049791161 8:144473312-144473334 CTGGGGCATGGAGGACTGCCAGG - Exonic
1054941153 9:70743636-70743658 AGGGGGCACTGAGGTCAGCCAGG + Intronic
1057916849 9:99063305-99063327 GGAGGGCAGAGACGTCTACCTGG + Intronic
1059117200 9:111610263-111610285 CTGAGGCTGAGAGCTCTGCCTGG + Intergenic
1059456674 9:114404118-114404140 TGGGGTCAGGGAGGGCTGCCTGG + Intronic
1060111709 9:120911302-120911324 CAGGGGCACAGAGACCTGCCTGG - Intronic
1060406151 9:123373971-123373993 GTGGGGCAGAGAAGTCTGCCAGG + Intronic
1060979480 9:127784475-127784497 CGGGGACAGAGAGGCCAGACTGG + Intergenic
1061293843 9:129666624-129666646 CCGGGGAAGAGAGGCCTGGCTGG - Intronic
1061495495 9:130971550-130971572 CGGGGGCAGAGGGGCCTGGGAGG - Intergenic
1061734276 9:132642170-132642192 CAGGCACAGAGAGGTTTGCCAGG + Intronic
1062182504 9:135198206-135198228 CGGGGGCTGAGAAGGCTTCCTGG - Intergenic
1062357394 9:136171274-136171296 CTGGGGCAGAGACGTGGGCCAGG - Intergenic
1185823996 X:3231613-3231635 CAAGGGCAGAGATGTCAGCCTGG - Intergenic
1186461017 X:9748700-9748722 GTGGGGCACAGAGGCCTGCCTGG + Intronic
1187272508 X:17791984-17792006 CATGGGGAGAGAGGTTTGCCAGG + Intergenic
1189464688 X:41269381-41269403 CGGGGGCAGAAGGTTCTTCCAGG + Intergenic
1190732520 X:53234810-53234832 TGGGGGAAGAGAGGGCTGCTGGG + Exonic
1194985405 X:100484728-100484750 CTGGGGAAGAAAGGTCTACCTGG + Intergenic
1195129873 X:101841207-101841229 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG + Intronic
1195182501 X:102368477-102368499 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1195202249 X:102563308-102563330 TAGGGGCAGAGCAGTCTGCCTGG + Intergenic
1195759030 X:108226359-108226381 TGGGGGCAGAGATGTGTGCTTGG + Intronic
1199717271 X:150515628-150515650 CAGGGGCAGTGAGGCCAGCCTGG - Intergenic
1200176038 X:154116949-154116971 CACGGGCAGAGAGGTTTGCCTGG + Intergenic