ID: 1195178427

View in Genome Browser
Species Human (GRCh38)
Location X:102333424-102333446
Sequence CATGGGTGCCAGCTCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195178421_1195178427 14 Left 1195178421 X:102333387-102333409 CCGGCTGCTGCAGCGGGTGGGGA No data
Right 1195178427 X:102333424-102333446 CATGGGTGCCAGCTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195178427 Original CRISPR CATGGGTGCCAGCTCTCCAC TGG Intergenic
No off target data available for this crispr