ID: 1195179095 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:102339557-102339579 |
| Sequence | GTTTCTAGGCAGAAGGGGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195179095_1195179106 | 19 | Left | 1195179095 | X:102339557-102339579 | CCCACCCCCTTCTGCCTAGAAAC | No data | ||
| Right | 1195179106 | X:102339599-102339621 | AATCACAGCGCCCAGACTGTAGG | No data | ||||
| 1195179095_1195179108 | 29 | Left | 1195179095 | X:102339557-102339579 | CCCACCCCCTTCTGCCTAGAAAC | No data | ||
| Right | 1195179108 | X:102339609-102339631 | CCCAGACTGTAGGTGCTAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195179095 | Original CRISPR | GTTTCTAGGCAGAAGGGGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||