ID: 1195179095

View in Genome Browser
Species Human (GRCh38)
Location X:102339557-102339579
Sequence GTTTCTAGGCAGAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195179095_1195179106 19 Left 1195179095 X:102339557-102339579 CCCACCCCCTTCTGCCTAGAAAC No data
Right 1195179106 X:102339599-102339621 AATCACAGCGCCCAGACTGTAGG No data
1195179095_1195179108 29 Left 1195179095 X:102339557-102339579 CCCACCCCCTTCTGCCTAGAAAC No data
Right 1195179108 X:102339609-102339631 CCCAGACTGTAGGTGCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195179095 Original CRISPR GTTTCTAGGCAGAAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr