ID: 1195179221

View in Genome Browser
Species Human (GRCh38)
Location X:102340098-102340120
Sequence TTCCCACCAGAACTTCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195179214_1195179221 12 Left 1195179214 X:102340063-102340085 CCATGGCTTGGGTGGCTGCAGGG No data
Right 1195179221 X:102340098-102340120 TTCCCACCAGAACTTCGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195179221 Original CRISPR TTCCCACCAGAACTTCGAAG GGG Intergenic
No off target data available for this crispr