ID: 1195180437

View in Genome Browser
Species Human (GRCh38)
Location X:102353659-102353681
Sequence CATGGGTGCCAGCTCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195180437_1195180443 14 Left 1195180437 X:102353659-102353681 CCAGTGGAGAGCTGGCACCCATG No data
Right 1195180443 X:102353696-102353718 TCCCCACCCGCTGCAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195180437 Original CRISPR CATGGGTGCCAGCTCTCCAC TGG (reversed) Intergenic
No off target data available for this crispr