ID: 1195186990

View in Genome Browser
Species Human (GRCh38)
Location X:102410108-102410130
Sequence CTACATACACACATCAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 2, 1: 0, 2: 2, 3: 47, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195186989_1195186990 -3 Left 1195186989 X:102410088-102410110 CCTGGGTTGCGAGGATGGTGCTA 0: 2
1: 0
2: 1
3: 29
4: 793
Right 1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG 0: 2
1: 0
2: 2
3: 47
4: 190
1195186985_1195186990 13 Left 1195186985 X:102410072-102410094 CCAAGTGGGATTTATCCCTGGGT 0: 3
1: 147
2: 435
3: 860
4: 1290
Right 1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG 0: 2
1: 0
2: 2
3: 47
4: 190
1195186988_1195186990 -2 Left 1195186988 X:102410087-102410109 CCCTGGGTTGCGAGGATGGTGCT 0: 2
1: 0
2: 0
3: 15
4: 480
Right 1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG 0: 2
1: 0
2: 2
3: 47
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195186990 Original CRISPR CTACATACACACATCAATCA AGG Intronic
906467578 1:46097150-46097172 CAACAAACAAAAATCAATCAAGG + Intronic
908494817 1:64683892-64683914 CTACATACACCCATTAAACAAGG + Intronic
908717863 1:67089128-67089150 CCAAATGCACACATCAACCAAGG + Intergenic
911619140 1:100047347-100047369 CAACATACATAAATCTATCAAGG - Intronic
916140919 1:161696995-161697017 CAACATACACAAATCAATAAAGG + Intergenic
916253356 1:162760884-162760906 ATAGATACACACACGAATCAGGG - Intronic
917072589 1:171168799-171168821 ATACACACACACACCAATTAGGG - Intergenic
918592796 1:186258897-186258919 CAACATACACAAATCAATAAAGG - Intergenic
918612472 1:186508694-186508716 CAACATATACAAATCAATAAAGG - Intergenic
920955049 1:210611805-210611827 CCACATACGCAAATCAATAAAGG - Intronic
921833735 1:219757057-219757079 CTACATTCACACAGCAAGCCAGG - Intronic
924170286 1:241332309-241332331 CTACACCAAAACATCAATCATGG - Intronic
1063351630 10:5362172-5362194 CCACATTCACACATCAGCCATGG + Intergenic
1064709172 10:18106025-18106047 CTAAAAACAGACTTCAATCATGG + Intergenic
1065870844 10:29955337-29955359 ATACATACATACATAAATAAAGG + Intergenic
1067697024 10:48542881-48542903 CTACATACAGACACCAACCTGGG - Intronic
1067998751 10:51306465-51306487 CAACATACACATATCAACTATGG - Intronic
1068087756 10:52395784-52395806 CTACATACAAAAGTCACTCAAGG - Intergenic
1068357745 10:55932052-55932074 CTACATTTACACATCAATTTAGG - Intergenic
1069128748 10:64672022-64672044 TTACACACACACAAAAATCAGGG + Intergenic
1069353991 10:67562331-67562353 CAACATACACAAATCAATAAAGG + Intronic
1071074936 10:81738744-81738766 CAACATACACAAATCAATAAAGG + Intergenic
1072316403 10:94207481-94207503 CTATATACACAAATAAATGAGGG + Intronic
1075102742 10:119517706-119517728 ACACATACACACATGAATCCAGG + Intronic
1076663724 10:132073110-132073132 CTACATACACACACACAACATGG - Intergenic
1076910318 10:133384714-133384736 CTCCATCCCCACATCACTCATGG - Intronic
1079807351 11:24950045-24950067 CTCCATATACCCATCCATCATGG - Intronic
1079900111 11:26172619-26172641 CAACATACACAAATCAAGAAAGG + Intergenic
1081037437 11:38166298-38166320 CAATATACACAAATCAATAAAGG - Intergenic
1081734392 11:45393050-45393072 CTTCATAGAAACATCAAGCAGGG - Intergenic
1082638396 11:55624900-55624922 CAACATACACAAATCAATGAAGG - Intergenic
1082716158 11:56616369-56616391 ATACATACACACATACATTAGGG - Intergenic
1083053453 11:59797128-59797150 CTACATACAGACATCCTTCTAGG - Intronic
1083368702 11:62160619-62160641 CAACATAAGCAAATCAATCAAGG + Intergenic
1084442293 11:69181542-69181564 CAACAAGCACACTTCAATCAGGG - Intergenic
1086055757 11:82644181-82644203 CTGAATAAACACATCATTCAAGG + Intergenic
1087697505 11:101396789-101396811 CAACATACAAAAATCAATAAAGG - Intergenic
1088111048 11:106261857-106261879 AAACATACACATATAAATCAAGG - Intergenic
1091061940 11:132471800-132471822 CTAAATACACTCAACAATCTAGG + Intronic
1093592948 12:20928143-20928165 CAACATACACTAATCAATAAAGG - Intergenic
1093606969 12:21103839-21103861 CAACATACACAAATAAATAAAGG - Intronic
1094225057 12:28035669-28035691 CTACATACATAAATCACACAGGG + Intergenic
1095933773 12:47654993-47655015 CTTCATACACACATAAACCTTGG + Intergenic
1098417406 12:70251067-70251089 CTACATAAACACATGAATTAAGG - Intronic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1099858193 12:88196302-88196324 CTACATACACACATTTTTAATGG + Exonic
1100537817 12:95527443-95527465 CTACATATACACATCAACAGAGG + Intronic
1100598742 12:96093964-96093986 CTACAGACACCCAGCAATCATGG - Intergenic
1101703418 12:107197052-107197074 CTACTTTCTAACATCAATCAAGG + Intergenic
1102032935 12:109753413-109753435 ATACATACACACCCCCATCAGGG - Intronic
1105384919 13:19920723-19920745 ATACATACACACATAAATGAAGG - Intergenic
1105776206 13:23663314-23663336 CAACATATAGACATCAATAAAGG - Intronic
1107810326 13:44194137-44194159 CTTCATTCACTCATTAATCACGG + Intergenic
1108503264 13:51086935-51086957 CCACAGATACACATCTATCAAGG + Intergenic
1109228688 13:59728648-59728670 TTATATATAAACATCAATCATGG + Intronic
1109317044 13:60762240-60762262 CAACATACACAAATCAATAAAGG - Intergenic
1109359379 13:61275999-61276021 GAACGTACACACATCCATCATGG - Intergenic
1109964220 13:69670567-69670589 CAAAATACACAAATCAATAAAGG + Intergenic
1110124326 13:71923497-71923519 CTAAATACACACATTAATAATGG + Intergenic
1110975589 13:81830033-81830055 CTACATATACACATATATGATGG - Intergenic
1112142786 13:96664230-96664252 TTACATACACACAGCATGCATGG - Intronic
1112689224 13:101870992-101871014 ATACATACATACATAAAACAAGG + Intronic
1113038071 13:106073086-106073108 CTACATAGAAAAGTCAATCAAGG - Intergenic
1113213452 13:108009830-108009852 CTACAGAGACAGATCAATAAGGG - Intergenic
1116371284 14:44136194-44136216 CTACCTCTACACATCAATTAGGG - Intergenic
1116504466 14:45661805-45661827 CAGCATACACAAATCAATAAAGG - Intergenic
1116552892 14:46265094-46265116 CAACATACACAAATCAATAAAGG + Intergenic
1116929969 14:50680852-50680874 CAACATACACAAATCAAACATGG - Intergenic
1118668531 14:68097807-68097829 ATACAAACACACATCATTCCAGG + Intronic
1119169343 14:72522027-72522049 GTAGCTACACACATAAATCAAGG - Intronic
1119621580 14:76135795-76135817 CCACACACACACACCAAGCATGG - Intergenic
1120271416 14:82318382-82318404 CAACATACGCAAATCAATAAAGG - Intergenic
1121319596 14:92983612-92983634 CGACAAACACACATCAATCGAGG + Intronic
1121620017 14:95339932-95339954 CTACATACACCTATAAATAAAGG - Intergenic
1123214875 14:106798870-106798892 CAACATACACAAATCAATAAAGG - Intergenic
1123219203 14:106840891-106840913 CTACGTCCACACAGCAATGAAGG + Intergenic
1124240763 15:28025786-28025808 CTACACACATACATCAAGCATGG - Intronic
1127047191 15:55038694-55038716 ATACATACAGTCAACAATCATGG - Intergenic
1127337807 15:58007141-58007163 CAACAGAAACACATAAATCAAGG + Intronic
1131206796 15:90456085-90456107 GTACATAAACAAATCAATCATGG - Intronic
1134892632 16:17854483-17854505 ATACATACATACATACATCATGG - Intergenic
1135279646 16:21142898-21142920 CTCAATAAACACAACAATCAAGG + Intronic
1139426625 16:66884470-66884492 CTACAGACACACATCAACAGAGG + Exonic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1146010155 17:29187648-29187670 CTACAGACACACATCATGCCAGG - Intergenic
1148359240 17:46998297-46998319 CTACATACACAGCACACTCACGG - Intronic
1151093120 17:71465143-71465165 ATACACACACACACCAATCTAGG + Intergenic
1153454530 18:5265516-5265538 CAACATACACAAATCAATAAAGG + Intergenic
1159256759 18:65956984-65957006 ATACATACACACCAGAATCAGGG - Intergenic
1159397094 18:67873817-67873839 CTACAGTCACACATCACTCCTGG + Intergenic
1162671838 19:12264248-12264270 CTACATACTCACACCTATCAAGG - Intronic
1163137340 19:15322022-15322044 ATACACACACACACAAATCAAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926449584 2:12986052-12986074 CCACATGCATTCATCAATCAAGG + Intergenic
926989500 2:18662421-18662443 GAATATACACACATGAATCATGG - Intergenic
928133500 2:28670597-28670619 ATACATACATACATAAATGAAGG + Intergenic
930859992 2:56061951-56061973 CAACATACACAAATCAATAAAGG - Intergenic
930951729 2:57150723-57150745 CAAAATACACAAATCAATAAAGG + Intergenic
931141121 2:59459318-59459340 CTACATTCACTCAACATTCAAGG - Intergenic
933397048 2:81746037-81746059 GAACATACACAAATCAATAAAGG - Intergenic
938774581 2:134530257-134530279 TTAAACACACACATCAATCAAGG - Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942474808 2:176308198-176308220 CAACATACGCAAATCAATAAAGG - Intronic
943539505 2:189194897-189194919 CAACATACACAAATCAGTAAAGG - Intergenic
944363546 2:198889506-198889528 CTACACACACACATGCTTCAAGG + Intergenic
945824447 2:214703461-214703483 CAACATAGACAAATCAATAAAGG + Intergenic
1169457485 20:5764906-5764928 CTACAAATACAAGTCAATCAAGG - Intronic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1171772466 20:29334295-29334317 CAACATACAAAAATCAATAAAGG + Intergenic
1174995496 20:55563074-55563096 CAACATATACAAATCAATAAAGG - Intergenic
1178800268 21:35788161-35788183 CAACATACACAAATCAATAAAGG + Intronic
1181379977 22:22494329-22494351 CTCCATCCAACCATCAATCAAGG + Intronic
1182950104 22:34366024-34366046 GTACATACACATATACATCATGG - Intergenic
1183017239 22:34999142-34999164 GCACACACACACACCAATCAGGG - Intergenic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1183849174 22:40569761-40569783 ATACATACATACATACATCAAGG + Intronic
949781935 3:7699383-7699405 CTACATACACATTTCAAACCAGG + Intronic
950767085 3:15280861-15280883 AGACACACACACACCAATCAGGG + Intronic
951478452 3:23133619-23133641 GCACACACACACATCACTCAGGG - Intergenic
951916469 3:27805917-27805939 ATACATACACACATAAATGTGGG - Intergenic
952401669 3:32969027-32969049 CCACATCCACACAGCAATGAAGG - Intergenic
953474928 3:43196965-43196987 ATCCATACACAAATCAAGCATGG - Intergenic
954528894 3:51300701-51300723 CAACATACACAAATCAATAAAGG - Intronic
958029338 3:88088737-88088759 ATACATACATACATAAATAAAGG - Intronic
958178813 3:90031007-90031029 CTACATCCACCCAACATTCAAGG - Intergenic
959074336 3:101734382-101734404 GTACATACACACATGCATTATGG + Intronic
959821897 3:110745300-110745322 CAACACACACAAATCAATAAAGG + Intergenic
960917675 3:122713446-122713468 TTTCATACACACCTGAATCAGGG - Exonic
962817921 3:139019831-139019853 CCACGTACACACAACAATCCTGG - Exonic
963393551 3:144702037-144702059 ATATATATACACATCAATTATGG + Intergenic
963578563 3:147095496-147095518 CAATATACACAAATCAATAAAGG - Intergenic
964455130 3:156855961-156855983 CTTCATAGACCTATCAATCAAGG - Intronic
965014175 3:163135073-163135095 CTGAACACACACATAAATCATGG + Intergenic
965195449 3:165588854-165588876 CAATATACACAAATCAATAAAGG + Intergenic
965860953 3:173149497-173149519 CAACATACACAAATCAATCAAGG + Intergenic
965974291 3:174602925-174602947 CAACATACACAAATCAATCAGGG - Intronic
967698119 3:192557761-192557783 CAACTTACAAAAATCAATCAAGG + Intronic
968929167 4:3567426-3567448 GTACACACACACGTAAATCACGG + Intergenic
970309147 4:14763438-14763460 CTACAGACAAAAATCAGTCAGGG + Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973191212 4:47388069-47388091 CTACATCTACAAATTAATCAAGG + Intronic
974813328 4:66973709-66973731 CTACTTACAAACACCAAACAGGG + Intergenic
975092465 4:70420206-70420228 CAACATACACAAATCAATAAAGG - Intergenic
975391658 4:73825170-73825192 CTACATAGCTACAACAATCAAGG - Intergenic
975500224 4:75076530-75076552 CGACATACACAAATCAATAAAGG - Intergenic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
976937569 4:90657051-90657073 CTACATACAGTCATCTATCTGGG + Intronic
977167358 4:93716226-93716248 GCACATACACACATGAATTAAGG + Intronic
978829095 4:113061200-113061222 CTACCTTCACAAATCAAACATGG - Intronic
979012166 4:115386292-115386314 CAATATACACAAATCAATAAAGG - Intergenic
979103820 4:116659051-116659073 CTACATAAGCAAATCAATAAAGG + Intergenic
982243996 4:153331019-153331041 CAACATACAAAAATCAATTATGG + Intronic
982725211 4:158899147-158899169 CAACATACACAAATCAATAAAGG - Intronic
982843104 4:160217738-160217760 CAACATACAGAAATCAATAAAGG - Intergenic
983424191 4:167561306-167561328 CAACCTACACAAATCAATAAAGG - Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986120282 5:4829095-4829117 CTGTATACTCACATCAATGAGGG + Intergenic
986582031 5:9275675-9275697 CAACATACACAAATCAGTCAAGG + Intronic
986647959 5:9936880-9936902 CCACATACACAAATCAATAAAGG - Intergenic
993208437 5:84917383-84917405 CTACATACACAAATCAATACAGG + Intergenic
993356078 5:86909469-86909491 CTCTATATACACATCAATCATGG + Intergenic
993435242 5:87884880-87884902 CAACATACGCAAATCAATAAAGG - Intergenic
993885294 5:93408934-93408956 ATACATACACACACCAGGCATGG + Intergenic
995178142 5:109202444-109202466 ATACACACACACACAAATCAGGG + Intergenic
998031179 5:138869579-138869601 CTTCCTACACACAGCTATCAGGG - Exonic
998874553 5:146586254-146586276 CTTCATCCACACATTCATCACGG + Intronic
999050561 5:148520015-148520037 GCACAAACACACATCAAACAAGG + Intronic
999970411 5:156855461-156855483 CAACATACACAAATGACTCAGGG + Intergenic
1001018335 5:168161832-168161854 ACACACACACACATCAATAAAGG + Intronic
1001090136 5:168733757-168733779 GTACATTCACACATCTATCCTGG + Intronic
1003819570 6:9881292-9881314 CAACATACACAAATCAATAAAGG + Intronic
1005437588 6:25831656-25831678 CCACACACACACATAAATGATGG + Intronic
1006373791 6:33660540-33660562 CATCATCCACACATTAATCAAGG + Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008667189 6:53727797-53727819 CTACACGTTCACATCAATCAGGG - Intergenic
1008913783 6:56764549-56764571 CTACAAACAGACATGAAACAAGG - Intronic
1009700041 6:67165048-67165070 CTTAATACACACTTCTATCAGGG + Intergenic
1009979640 6:70712232-70712254 TAACATACACAAATCAATCAAGG - Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010299170 6:74239542-74239564 CAACATACGCAAATCAATCAAGG - Intergenic
1010362296 6:75008909-75008931 CAACATACACAAATCAATAAAGG + Intergenic
1010648473 6:78422845-78422867 CAACATACACAAATCAATAAAGG + Intergenic
1011681145 6:89784375-89784397 CTATATACCTACATCAATAAAGG + Intronic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1013919754 6:115389932-115389954 CAACATACATAAATCAATAAAGG - Intergenic
1014123174 6:117749428-117749450 CAACATACACAAATCAATAAAGG + Intergenic
1015291507 6:131542730-131542752 CAACATACACAAATCAATAAAGG + Intergenic
1015711096 6:136141265-136141287 CAACATACGCAAATCAATAAAGG - Intronic
1015742237 6:136469199-136469221 CTAAATCCACACATCATTCTTGG + Intronic
1018108875 6:160515745-160515767 CAACATACACAAATCAATAAGGG + Intergenic
1019855633 7:3603981-3604003 CAACATACGCAAATCAATAAAGG - Intronic
1020358067 7:7299445-7299467 CAACATACACAAATCAATAAAGG - Intergenic
1020557299 7:9686444-9686466 ATACATACACATATACATCATGG - Intergenic
1024173893 7:46818773-46818795 ATATATATAAACATCAATCATGG + Intergenic
1027975660 7:85151566-85151588 ATGCATACACACATCAACTACGG - Intronic
1031391726 7:121223256-121223278 CAACACACACAAATCAATAAAGG - Intronic
1032686837 7:134242895-134242917 CAACATACGCAAATCAATAAAGG + Intronic
1032894172 7:136232654-136232676 CTAAATCCACTCATCATTCAAGG - Intergenic
1034544331 7:151779983-151780005 CTACACACACCCCTCACTCAAGG - Intronic
1035916426 8:3629359-3629381 CTAAATACACATATAAATAATGG - Intronic
1035950430 8:4013933-4013955 TTACATACACTTATCAATCAGGG - Intronic
1037479798 8:19293796-19293818 ACACATACACACACAAATCAAGG - Intergenic
1038154364 8:24973938-24973960 CTACATACATACATGTGTCAGGG - Intergenic
1038537184 8:28361659-28361681 CAGCACACACACATCAACCACGG + Intronic
1038997594 8:32942407-32942429 CAACATATACATATCAATAAAGG - Intergenic
1039195624 8:35028213-35028235 CTACATACATACATATATAAAGG + Intergenic
1043699601 8:83269089-83269111 TCACATACACAAATCAATAAAGG + Intergenic
1044165266 8:88974855-88974877 CAACATACGCAAATCAATAAAGG + Intergenic
1045113946 8:98961981-98962003 CTAGCTTCACACATCAACCAAGG - Intergenic
1046494737 8:114998802-114998824 CTACATGCAGACATTAATCAGGG + Intergenic
1049659555 8:143813660-143813682 CTGCAGAGACACATCATTCAGGG + Exonic
1050637782 9:7630334-7630356 CAACATACTCAAATCAATAAAGG + Intergenic
1050709484 9:8444419-8444441 CTACATACACAAATTAATTCTGG + Intronic
1054192172 9:61992300-61992322 ATACACACACACACAAATCACGG + Intergenic
1054835025 9:69668075-69668097 CAACATACAGACATCCCTCAAGG + Intronic
1056255881 9:84799127-84799149 CTCCATCTTCACATCAATCAAGG + Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG + Intronic
1187605543 X:20878431-20878453 CAACATACACAAATCAATAAAGG + Intergenic
1187788663 X:22922875-22922897 CTAAATACAAACATCATTTAAGG + Intergenic
1187881519 X:23851912-23851934 ATACATACATACATAAAACAGGG - Intronic
1191125649 X:56951036-56951058 CAACATACACAAATCAATAAAGG - Intergenic
1191590777 X:62881949-62881971 CAATATACACAAATCAATAAAGG + Intergenic
1191651314 X:63540852-63540874 CAACATACGCAAATCAATAAAGG + Intergenic
1191876580 X:65803524-65803546 GTACATACACAAAGCAATCTGGG - Intergenic
1191984663 X:66967075-66967097 CAACATACACAAATAAATTAAGG - Intergenic
1192910467 X:75598803-75598825 CAATATACACAAATCAATAAAGG - Intergenic
1193204515 X:78732252-78732274 CAACATATGCAAATCAATCAGGG - Intergenic
1193514716 X:82449229-82449251 CAACATACACAAATCAATACAGG + Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195332482 X:103815283-103815305 CAACATACACATATCAATAAAGG + Intergenic
1195417659 X:104637611-104637633 CAGCATACACAAATCAATAAGGG - Intronic
1197277512 X:124497080-124497102 CAACATACACACTGCCATCAGGG + Exonic
1197395249 X:125919640-125919662 CAACATACACAAATTAATAAAGG - Intergenic
1197971415 X:132118965-132118987 CCACATACACACTTCAATCTAGG + Intronic
1198597057 X:138247987-138248009 ATATATAGACACATCATTCATGG - Intergenic
1198926420 X:141801535-141801557 CAACATACGCAAATCAATAAAGG - Intergenic
1199302563 X:146230242-146230264 CAACAGACACAAATCAATAAGGG - Intergenic
1201325291 Y:12749573-12749595 CTATACACACCCATCCATCAAGG - Intronic
1201503100 Y:14667431-14667453 ATACATACACACATAAATACAGG + Intronic