ID: 1195190778

View in Genome Browser
Species Human (GRCh38)
Location X:102447303-102447325
Sequence CCTGTCCCGCCACTGTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2043
Summary {0: 2, 1: 9, 2: 66, 3: 326, 4: 1640}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195190775_1195190778 6 Left 1195190775 X:102447274-102447296 CCTCTTGGAATGAGAATGTCTAT 0: 2
1: 17
2: 83
3: 199
4: 493
Right 1195190778 X:102447303-102447325 CCTGTCCCGCCACTGTATTTTGG 0: 2
1: 9
2: 66
3: 326
4: 1640
1195190771_1195190778 28 Left 1195190771 X:102447252-102447274 CCTTTTCTGTTGCCTGTCTCTCC 0: 2
1: 0
2: 5
3: 60
4: 743
Right 1195190778 X:102447303-102447325 CCTGTCCCGCCACTGTATTTTGG 0: 2
1: 9
2: 66
3: 326
4: 1640
1195190773_1195190778 16 Left 1195190773 X:102447264-102447286 CCTGTCTCTCCCTCTTGGAATGA 0: 2
1: 0
2: 8
3: 115
4: 902
Right 1195190778 X:102447303-102447325 CCTGTCCCGCCACTGTATTTTGG 0: 2
1: 9
2: 66
3: 326
4: 1640
1195190774_1195190778 7 Left 1195190774 X:102447273-102447295 CCCTCTTGGAATGAGAATGTCTA 0: 2
1: 13
2: 111
3: 278
4: 580
Right 1195190778 X:102447303-102447325 CCTGTCCCGCCACTGTATTTTGG 0: 2
1: 9
2: 66
3: 326
4: 1640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195190778 Original CRISPR CCTGTCCCGCCACTGTATTT TGG Intronic
Too many off-targets to display for this crispr