ID: 1195193416

View in Genome Browser
Species Human (GRCh38)
Location X:102471836-102471858
Sequence TGGTACTTCCCAGACCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 0, 2: 2, 3: 7, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195193416_1195193428 23 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193428 X:102471882-102471904 ATCATCAGGGAGGAGTAGGACGG 0: 2
1: 0
2: 2
3: 19
4: 270
1195193416_1195193421 -3 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193421 X:102471856-102471878 CCATTGTAGCCAGGAAGAGAGGG 0: 2
1: 0
2: 0
3: 9
4: 247
1195193416_1195193419 -4 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193419 X:102471855-102471877 ACCATTGTAGCCAGGAAGAGAGG 0: 2
1: 0
2: 0
3: 17
4: 221
1195193416_1195193427 19 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193427 X:102471878-102471900 GGAGATCATCAGGGAGGAGTAGG 0: 2
1: 0
2: 3
3: 26
4: 303
1195193416_1195193424 9 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193424 X:102471868-102471890 GGAAGAGAGGGGAGATCATCAGG 0: 2
1: 0
2: 3
3: 45
4: 410
1195193416_1195193425 10 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193425 X:102471869-102471891 GAAGAGAGGGGAGATCATCAGGG 0: 2
1: 0
2: 1
3: 30
4: 350
1195193416_1195193426 13 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193426 X:102471872-102471894 GAGAGGGGAGATCATCAGGGAGG 0: 2
1: 0
2: 1
3: 25
4: 325
1195193416_1195193422 -2 Left 1195193416 X:102471836-102471858 CCAACCTGGTCTGGGAAGTACCA 0: 2
1: 0
2: 2
3: 7
4: 137
Right 1195193422 X:102471857-102471879 CATTGTAGCCAGGAAGAGAGGGG 0: 2
1: 0
2: 1
3: 44
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195193416 Original CRISPR TGGTACTTCCCAGACCAGGT TGG (reversed) Intergenic
900411178 1:2513401-2513423 TGGCCCTTCCCAGAAGAGGTGGG + Intronic
901848866 1:12002302-12002324 TCGTGCTGCACAGACCAGGTGGG - Intronic
903126938 1:21254763-21254785 TGGTGCTGCTCAGACCAGGATGG - Intronic
904298755 1:29540820-29540842 TAGGTCTTCCCAGACAAGGTTGG - Intergenic
905013530 1:34762323-34762345 CAGTACTTTGCAGACCAGGTGGG + Exonic
907577217 1:55537755-55537777 TGGTTCTACCCTGACCAGGCAGG + Intergenic
911104510 1:94119325-94119347 TGGTGCTTCCCAGACAAGTCAGG + Intronic
913085519 1:115433149-115433171 TGGTCCCTCCCACAACAGGTAGG - Intergenic
915019539 1:152766001-152766023 AGGTTCCTTCCAGACCAGGTGGG + Intronic
916959061 1:169871240-169871262 TGGTTCTTCCCAGGACACGTGGG - Intronic
920971272 1:210745592-210745614 TGGTACTTTCCAGAACAGTATGG - Intronic
921178227 1:212611216-212611238 AAGTTCTTCACAGACCAGGTAGG - Intronic
923120096 1:230981834-230981856 TGGTGTTTCTCAGACCAGGCAGG + Intronic
1064321403 10:14308793-14308815 TGGTACTTACAAAATCAGGTTGG + Intronic
1066653212 10:37678993-37679015 GGGTACTTCTCAGAGCAAGTGGG + Intergenic
1067037570 10:42931534-42931556 GGGTGCTTCCTAGAGCAGGTGGG + Intergenic
1067287596 10:44918195-44918217 TGGTCCCTCCCACAACAGGTGGG + Intronic
1067797888 10:49333964-49333986 TGGTACTTCCTGGATCAGGAAGG - Intergenic
1067812018 10:49437006-49437028 GGGTGCTTCCCACAACAGGTGGG - Intergenic
1067925343 10:50503047-50503069 TGGTTCTTCCCATGCTAGGTAGG - Intronic
1068354697 10:55896628-55896650 CGGTACTTCCCATAACATGTTGG + Intergenic
1070577671 10:77691901-77691923 TGGTCCTTCCCAGGACATGTGGG + Intergenic
1071185953 10:83045365-83045387 TGGTCCTTCCCACAACATGTGGG + Intergenic
1075818642 10:125286269-125286291 TGGTATTTCCCAGACCACACTGG + Intergenic
1076759955 10:132598984-132599006 GGGTTCTTCCCATAACAGGTGGG + Intronic
1081316956 11:41641693-41641715 TGGGGCCTCCCAGACCAGGAGGG - Intergenic
1082802609 11:57425839-57425861 AGGCACTTCCCAGATCAAGTGGG + Intronic
1083143121 11:60737964-60737986 TGGAACTTCCCAGTCCTGTTGGG - Intronic
1084149174 11:67280207-67280229 TGATGCTTCTCAGTCCAGGTGGG - Intronic
1086826887 11:91509055-91509077 GGGTACTTCCCACAACATGTGGG + Intergenic
1088522878 11:110718125-110718147 GGGTCCTTCCCACAACAGGTGGG - Intergenic
1093312501 12:17607802-17607824 TGGTACTTCCAAGGATAGGTCGG + Intergenic
1094229209 12:28083562-28083584 TTGTAATTCCCACACCTGGTGGG - Intergenic
1098115270 12:67169220-67169242 TGGTCCTTCCCACAACACGTGGG + Intergenic
1098476335 12:70908591-70908613 TGGTCCCTCCCACAACAGGTGGG + Intronic
1101277511 12:103218580-103218602 TGGTACTACCCAGACACGGCAGG + Intergenic
1101304500 12:103514240-103514262 TGGTCCTTCCCACAACATGTGGG + Intergenic
1102590277 12:113951354-113951376 TGGCACTTCACAGACCAGGGAGG - Intronic
1102600777 12:114028599-114028621 TAGTAAGTGCCAGACCAGGTTGG + Intergenic
1111592037 13:90360840-90360862 TGGTACCTCCCACAACATGTGGG - Intergenic
1111797336 13:92939147-92939169 GGGTCCTTCCCACAACAGGTGGG + Intergenic
1112071252 13:95852971-95852993 TGGTCCCTCCCACAACAGGTGGG - Intronic
1113856803 13:113450962-113450984 TGCTACTTAGCAGACCAGGAAGG - Intronic
1115171614 14:30514395-30514417 TGGTCCCTCCCACAACAGGTAGG + Intergenic
1119946990 14:78705388-78705410 TGGTTCTGCACAGAGCAGGTGGG + Intronic
1125110205 15:36023560-36023582 TTGTACTTCCCAGACCATCTGGG + Intergenic
1125704183 15:41717272-41717294 TGGTACTACCCACAACAGCTAGG - Intronic
1128366431 15:67006825-67006847 TGGTATTTCTCAGCCCAGGAAGG + Intergenic
1130030711 15:80311041-80311063 TGGTCCTTCCCACAACACGTGGG + Intergenic
1131743785 15:95422577-95422599 TGGTCCCTCCCACAGCAGGTGGG + Intergenic
1133498785 16:6345524-6345546 TGGGGATTCCCATACCAGGTCGG - Intronic
1144796730 17:17896492-17896514 GGGCACTTCCAAGACCAGGCTGG - Intronic
1146609097 17:34288830-34288852 TGGTTCTTCCCAGCCCAGTTAGG + Intergenic
1149072053 17:52555256-52555278 TGGTACCTCCCACAACATGTGGG - Intergenic
1152574234 17:81133090-81133112 GGGTACATCCCAGAGCAGGGTGG + Intronic
1155602559 18:27566487-27566509 AGGGACCTCCCAGTCCAGGTAGG - Intergenic
1159304944 18:66628812-66628834 AGGTACCTCCCACAACAGGTGGG + Intergenic
1159583463 18:70261001-70261023 AGGTACTTCCCACACCAGTGAGG + Intergenic
1162140012 19:8580182-8580204 TGGTCCTTTCCAGACCTGGGTGG + Intergenic
1164835985 19:31355296-31355318 TGTGGCTTCCTAGACCAGGTCGG - Intergenic
925821042 2:7800196-7800218 TGGTACTTCCCTGGACATGTGGG - Intergenic
927837310 2:26409585-26409607 TGGTACATCTCAGACAAGATAGG + Intronic
932055766 2:68441757-68441779 TAGTCCTGCCCAAACCAGGTGGG - Intergenic
938742844 2:134248950-134248972 TGGCATTTGCCAGACAAGGTGGG + Intronic
939081497 2:137667849-137667871 TAGTACTTACCAAACAAGGTAGG - Exonic
944244441 2:197516585-197516607 AGGTACTTCCCAGGCCAGGTAGG - Intronic
945903229 2:215561417-215561439 TGGTCCCTCCCACAACAGGTGGG - Intergenic
946766176 2:223043098-223043120 TGGTTCTTCACATACCAGGGAGG - Intergenic
947049525 2:226026646-226026668 TGGTCCTTCCCATAACATGTGGG - Intergenic
947899275 2:233706868-233706890 TGGCACTTCCCAGCTCTGGTTGG + Intronic
1169344004 20:4815869-4815891 TGATACTGCCCAGGCCAGGAAGG + Intronic
1172533530 20:35652877-35652899 GGGCACTTCCAAGACCAGGAGGG + Exonic
1174999764 20:55614312-55614334 TGCAAATTCCCAGACCAGCTGGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176657992 21:9605186-9605208 GGGTACCTCCCAGGCCAGGTGGG - Intergenic
1179460064 21:41528598-41528620 TTGAACTTCCCAGCACAGGTGGG - Intronic
1184124569 22:42478056-42478078 TGGTTCCTCCCACACCAGCTAGG - Intergenic
949490170 3:4581397-4581419 TTGTTCTTCCCAGACCAGTATGG + Intronic
950349089 3:12329030-12329052 TGGCTCATCCCAGCCCAGGTGGG + Intronic
955067586 3:55546237-55546259 TGGTCCTTCACAGACTAGGCTGG + Intronic
960391647 3:117084313-117084335 GGGTTCTTCCCACAACAGGTGGG - Intronic
969414655 4:7050540-7050562 TCGTCCTTCACAGACCAGATGGG + Intronic
970780903 4:19736385-19736407 GGGTCCTTCCCAGAACACGTAGG - Intergenic
972190534 4:36586259-36586281 GGGTCCTTCCCAGAACATGTGGG - Intergenic
976939679 4:90684707-90684729 AGGTCCTTCCCACAACAGGTGGG - Intronic
977087363 4:92619361-92619383 TGCAGCTTCCCAGACCAGGAGGG + Intronic
978277224 4:106966879-106966901 TGGTTCTTCCCACAACAAGTGGG + Intronic
982730621 4:158952300-158952322 TGGTCCTTCCCACAACATGTGGG - Intronic
985417419 4:189750887-189750909 GGGTACCTCCCAGGTCAGGTGGG + Intergenic
986947904 5:13047210-13047232 TGGTCCCTCCCACAACAGGTGGG + Intergenic
988012332 5:25505425-25505447 AGGTCCTTCCCACAACAGGTGGG + Intergenic
990129263 5:52559505-52559527 GGGTACTTCCCACAACACGTGGG + Intergenic
993717038 5:91285391-91285413 GGGCCCTTCCCAGAACAGGTAGG + Intergenic
994134753 5:96273243-96273265 TGGCACTTCACAGAACAGCTTGG - Intergenic
994409703 5:99391250-99391272 TTGTACTTCCAAAACCATGTGGG - Intergenic
994484117 5:100374033-100374055 TTGTACTTCCAAAACCATGTGGG + Intergenic
996222511 5:120950650-120950672 GGGTACTTCCCACAACACGTGGG - Intergenic
996933268 5:128916896-128916918 CTGTACTTCCGAGACCAAGTGGG - Intronic
997259723 5:132456683-132456705 TGGTATTTCACAGACAAGGGAGG + Intronic
997301668 5:132810635-132810657 AGGTACTTACCAGAGCACGTGGG - Intergenic
998217020 5:140245189-140245211 TGGCTCATCCCAGCCCAGGTGGG - Exonic
998908128 5:146928584-146928606 TGGTATTTCTCAGACTAGGATGG - Intronic
999234561 5:150082678-150082700 TGGTTCTTCCCTTACCAGCTGGG + Intronic
1001039291 5:168321253-168321275 TGGTTCTTCCCAGACCAAGTTGG - Intronic
1001261811 5:170236126-170236148 TGGGACTGCCAAGACCAGTTTGG + Intronic
1002167502 5:177357647-177357669 TGGTCCTGGCCAGACCAGGCTGG + Intergenic
1003254176 6:4459890-4459912 TCCTGTTTCCCAGACCAGGTTGG - Intergenic
1007729960 6:43939705-43939727 TGGCAGCTCCCAGACCAGGAGGG + Intergenic
1009726150 6:67537854-67537876 AGTTACTTCCCAGACCCTGTAGG - Intergenic
1010061097 6:71624298-71624320 AGGTTCTTCCCACAACAGGTGGG - Intergenic
1010427138 6:75740238-75740260 TGGTCCGTCCCACACCACGTGGG + Intergenic
1011110484 6:83832638-83832660 AGGTCCTTCCCACAACAGGTGGG - Intergenic
1015131509 6:129816502-129816524 TGGCACTTTCCACACAAGGTAGG + Intergenic
1015161667 6:130159117-130159139 TGGTCCTTCCCACAACAGGTGGG - Intronic
1017031884 6:150231001-150231023 TGGTACTGGCTAGAGCAGGTGGG + Intronic
1017158421 6:151342378-151342400 AGGTACCTGCCAGACTAGGTAGG + Intronic
1018054697 6:160041654-160041676 TGGTATTTAGCAAACCAGGTGGG - Intronic
1018869639 6:167770965-167770987 TTGAACATCCCAGACCAGGATGG + Intergenic
1022105570 7:27193929-27193951 TGCTAATCCCCAGACCCGGTGGG - Intronic
1022302246 7:29112699-29112721 TGGTTCTTCCCAGCTCAGGTAGG - Exonic
1022796564 7:33736123-33736145 TGGTACCTCCCACAACACGTGGG - Intergenic
1027853645 7:83481913-83481935 TGGTATTTCCAAGACCAGCAAGG + Intronic
1032266509 7:130373776-130373798 CGGAACTTCCCAGACGTGGTGGG + Intergenic
1036603128 8:10281752-10281774 TGCTACTTCACAGACAGGGTGGG - Intronic
1036848618 8:12186401-12186423 TGCTACGTCCCAGTCCAGCTGGG + Exonic
1036869980 8:12428682-12428704 TGCTACGTCCCAGTCCAGCTGGG + Exonic
1038291300 8:26252136-26252158 TCGAACTTCCCAGCCCAGGATGG - Intergenic
1040284033 8:46091032-46091054 TGGCACTACCTAGACCCGGTGGG - Intergenic
1040782393 8:51125441-51125463 TGATACAGCCCAGACCAGCTTGG + Intergenic
1041403591 8:57471317-57471339 GGGTCCTTCCCACAACAGGTGGG + Intergenic
1041448005 8:57974870-57974892 TGCTACTTCACAGTGCAGGTAGG - Intergenic
1042714018 8:71752203-71752225 TGTTACATCCCAGACAAGGAAGG - Intergenic
1046776363 8:118167977-118167999 GGGTACTTCCCAAAACATGTGGG - Intergenic
1049154589 8:141059104-141059126 TGGTGGTTCCCAGAGCAGGCAGG - Intergenic
1052805546 9:33010161-33010183 TAGTAGTTCCCAGAACAGGAGGG + Intronic
1203635721 Un_KI270750v1:108761-108783 GGGTACCTCCCAGGCCAGGTGGG - Intergenic
1185740279 X:2526477-2526499 TGGTCCCTCCCACACCACGTGGG - Intergenic
1185831972 X:3311016-3311038 TGATACTTCTCAGAGGAGGTGGG + Exonic
1186497163 X:10020746-10020768 TGCCACCTCCCAGACCAGCTTGG - Intronic
1187894557 X:23968108-23968130 TGGTCCTTCCCACAACACGTGGG + Intergenic
1191697550 X:64005393-64005415 TGGTCCTTCCCACAGCATGTGGG + Intergenic
1195165442 X:102215255-102215277 TGGTACTTCCCAGACCAGGTTGG + Intergenic
1195193416 X:102471836-102471858 TGGTACTTCCCAGACCAGGTTGG - Intergenic
1195770057 X:108341373-108341395 GGGTCCTTCCCACAACAGGTGGG - Intronic
1198236288 X:134738570-134738592 TTGTACTTCCCAGAGAGGGTGGG - Intronic
1199981344 X:152922218-152922240 TGGATCTTGCCAGAGCAGGTGGG - Exonic
1201244032 Y:11986064-11986086 TGATACTTCTCAGAGGAGGTGGG - Intergenic
1201547490 Y:15181491-15181513 TGGTCCTTCCCATGACAGGTGGG - Intergenic