ID: 1195194813

View in Genome Browser
Species Human (GRCh38)
Location X:102487314-102487336
Sequence GTTGAAGCACAGAGGTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195194813_1195194815 -2 Left 1195194813 X:102487314-102487336 CCAAGTGACCTCTGTGCTTCAAC No data
Right 1195194815 X:102487335-102487357 ACTGTCCTCATCTGTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195194813 Original CRISPR GTTGAAGCACAGAGGTCACT TGG (reversed) Intergenic
No off target data available for this crispr