ID: 1195195728

View in Genome Browser
Species Human (GRCh38)
Location X:102496611-102496633
Sequence TCTAAACTGTAGTGAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195195722_1195195728 9 Left 1195195722 X:102496579-102496601 CCTTCCTCCTGAAGTGGCTTAAA No data
Right 1195195728 X:102496611-102496633 TCTAAACTGTAGTGAGTGTAGGG No data
1195195720_1195195728 18 Left 1195195720 X:102496570-102496592 CCAACACTTCCTTCCTCCTGAAG No data
Right 1195195728 X:102496611-102496633 TCTAAACTGTAGTGAGTGTAGGG No data
1195195725_1195195728 2 Left 1195195725 X:102496586-102496608 CCTGAAGTGGCTTAAAACCTGGT No data
Right 1195195728 X:102496611-102496633 TCTAAACTGTAGTGAGTGTAGGG No data
1195195723_1195195728 5 Left 1195195723 X:102496583-102496605 CCTCCTGAAGTGGCTTAAAACCT No data
Right 1195195728 X:102496611-102496633 TCTAAACTGTAGTGAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195195728 Original CRISPR TCTAAACTGTAGTGAGTGTA GGG Intergenic
No off target data available for this crispr