ID: 1195195746

View in Genome Browser
Species Human (GRCh38)
Location X:102496727-102496749
Sequence CTGTGAAAAAGGAGATCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195195741_1195195746 -1 Left 1195195741 X:102496705-102496727 CCTCATTGCCAATGGCTCCAACC No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data
1195195740_1195195746 2 Left 1195195740 X:102496702-102496724 CCTCCTCATTGCCAATGGCTCCA No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data
1195195737_1195195746 8 Left 1195195737 X:102496696-102496718 CCCACTCCTCCTCATTGCCAATG No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data
1195195742_1195195746 -9 Left 1195195742 X:102496713-102496735 CCAATGGCTCCAACCTGTGAAAA No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data
1195195736_1195195746 26 Left 1195195736 X:102496678-102496700 CCTCTTCATAGAGGCTGACCCAC No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data
1195195738_1195195746 7 Left 1195195738 X:102496697-102496719 CCACTCCTCCTCATTGCCAATGG No data
Right 1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195195746 Original CRISPR CTGTGAAAAAGGAGATCCTA AGG Intergenic
No off target data available for this crispr