ID: 1195199050

View in Genome Browser
Species Human (GRCh38)
Location X:102529703-102529725
Sequence AAACTTTGACTACAATTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195199044_1195199050 21 Left 1195199044 X:102529659-102529681 CCAAGAAATAAAAGTGAGTCATT No data
Right 1195199050 X:102529703-102529725 AAACTTTGACTACAATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195199050 Original CRISPR AAACTTTGACTACAATTGAT AGG Intergenic
No off target data available for this crispr