ID: 1195201015

View in Genome Browser
Species Human (GRCh38)
Location X:102550089-102550111
Sequence GAGGTGGGTAGGAGGTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195201003_1195201015 1 Left 1195201003 X:102550065-102550087 CCCTTGGACAGGCCCTGAGAGCC 0: 1
1: 0
2: 3
3: 13
4: 166
Right 1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG No data
1195201004_1195201015 0 Left 1195201004 X:102550066-102550088 CCTTGGACAGGCCCTGAGAGCCA 0: 1
1: 0
2: 2
3: 36
4: 266
Right 1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG No data
1195200999_1195201015 25 Left 1195200999 X:102550041-102550063 CCAGAAGGCAAGCACCTGCTTAC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG No data
1195201002_1195201015 11 Left 1195201002 X:102550055-102550077 CCTGCTTACTCCCTTGGACAGGC 0: 1
1: 0
2: 3
3: 7
4: 102
Right 1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195201015 Original CRISPR GAGGTGGGTAGGAGGTTAAG GGG Intergenic
No off target data available for this crispr