ID: 1195201789

View in Genome Browser
Species Human (GRCh38)
Location X:102558193-102558215
Sequence CTTTATGTACAGCTTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195201786_1195201789 13 Left 1195201786 X:102558157-102558179 CCTATAAAAATAAAATTTCATCA No data
Right 1195201789 X:102558193-102558215 CTTTATGTACAGCTTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195201789 Original CRISPR CTTTATGTACAGCTTGCACA GGG Intergenic
No off target data available for this crispr