ID: 1195202696

View in Genome Browser
Species Human (GRCh38)
Location X:102565436-102565458
Sequence CCAGTGGGGTAGCAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195202684_1195202696 24 Left 1195202684 X:102565389-102565411 CCTGACCTGGTCTTGGCCAGGGG No data
Right 1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG No data
1195202687_1195202696 19 Left 1195202687 X:102565394-102565416 CCTGGTCTTGGCCAGGGGCAGGC No data
Right 1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG No data
1195202691_1195202696 -3 Left 1195202691 X:102565416-102565438 CCAGGCAGATTGACGGACAGCCA No data
Right 1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG No data
1195202689_1195202696 8 Left 1195202689 X:102565405-102565427 CCAGGGGCAGGCCAGGCAGATTG No data
Right 1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195202696 Original CRISPR CCAGTGGGGTAGCAGAGCCC TGG Intergenic
No off target data available for this crispr