ID: 1195215161

View in Genome Browser
Species Human (GRCh38)
Location X:102691910-102691932
Sequence GGTAACGGGTGCATCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195215161_1195215167 26 Left 1195215161 X:102691910-102691932 CCTGGTGAGATGCACCCGTTACC No data
Right 1195215167 X:102691959-102691981 TCTTCTGCGTCGCTCACGCTGGG 0: 1207
1: 1733
2: 1834
3: 1455
4: 900
1195215161_1195215166 25 Left 1195215161 X:102691910-102691932 CCTGGTGAGATGCACCCGTTACC No data
Right 1195215166 X:102691958-102691980 GTCTTCTGCGTCGCTCACGCTGG 0: 1039
1: 1459
2: 1651
3: 1499
4: 1137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195215161 Original CRISPR GGTAACGGGTGCATCTCACC AGG (reversed) Intergenic
No off target data available for this crispr