ID: 1195218748

View in Genome Browser
Species Human (GRCh38)
Location X:102725910-102725932
Sequence TAACATAGAACTAGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195218746_1195218748 24 Left 1195218746 X:102725863-102725885 CCATGCATCAGAGTCTTTTTATT No data
Right 1195218748 X:102725910-102725932 TAACATAGAACTAGTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195218748 Original CRISPR TAACATAGAACTAGTGTTGA GGG Intronic