ID: 1195220657

View in Genome Browser
Species Human (GRCh38)
Location X:102742976-102742998
Sequence GGACAACTCCAAGAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 22, 3: 139, 4: 451}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195220657 Original CRISPR GGACAACTCCAAGAGGGGAA GGG Intronic
900645634 1:3707476-3707498 GGACACCTCCTAGACGGGACAGG + Intronic
900854093 1:5166841-5166863 GGACAACTCAAAGTGGGGAGGGG + Intergenic
901460719 1:9389778-9389800 GGACAATTCGAAGTGGGGAGGGG - Intergenic
901684332 1:10935248-10935270 GGCCCACTCCAAGAGGTGAGGGG - Intergenic
902042160 1:13500545-13500567 GGACAACTTGAAGTGGGGAGGGG - Intronic
902083103 1:13834768-13834790 GGACAACTTGAAGTGGGGAGCGG + Intergenic
903117539 1:21190617-21190639 GGACAACTGGAAGTGGGGAGGGG - Intergenic
903393690 1:22983051-22983073 GGACAACTCGAAGCGGGGAGGGG + Intergenic
903596023 1:24495433-24495455 GGACAACTTGAAGCGGGGAAGGG + Intergenic
904394545 1:30209969-30209991 GGACAACCCAAAGCGGGGAATGG - Intergenic
904398521 1:30240227-30240249 GGACAACTCGAAGCGGGGAGAGG - Intergenic
904751203 1:32742155-32742177 GGACAAGGCCAAGAGGGCCAAGG + Exonic
904752336 1:32748765-32748787 GGATACCTCCAATAGGGGAGTGG + Intronic
905059815 1:35130328-35130350 GGACAACTCGATGTGGGGAGGGG + Intergenic
906377304 1:45305413-45305435 GGACAACTCGAAGTGGGGAGGGG - Intronic
907627264 1:56042476-56042498 GTACATCTCTAGGAGGGGAAGGG - Intergenic
908880166 1:68723038-68723060 GGACAACTTGAAGTGGGGAGGGG - Intergenic
909050029 1:70755241-70755263 GGACAACTCCAAGTGGGGAGGGG - Intergenic
910121583 1:83796432-83796454 GGACAACTTGAAGAGGGGAGGGG + Intergenic
911091308 1:94019491-94019513 GGACCAGACCAAGAGGGGAGGGG - Intronic
912062867 1:105695796-105695818 AAACTACTCCAAGAGGGGAAAGG + Intergenic
914717500 1:150264785-150264807 GGACATCTCCTAGAGAGGAATGG + Exonic
914808509 1:151009047-151009069 GGAGAACTCAAAGAGGGGCGGGG - Intronic
916074663 1:161193506-161193528 GGACAATTCCCAGAGGTTAAAGG + Intronic
916623442 1:166526979-166527001 GGACAACTCGAAGCAGGGAGGGG - Intergenic
917085147 1:171297437-171297459 GGTCAAATGCAATAGGGGAAAGG + Intergenic
917099375 1:171430245-171430267 GGACAACTTGAAGTGGGGAGGGG - Intergenic
917508330 1:175649073-175649095 GGACAGCTCCAAGCAGGGAGGGG - Intronic
918461611 1:184782777-184782799 AGACAACTTGAAGAAGGGAATGG - Intergenic
918968631 1:191383040-191383062 GGACAACTCGAAGCAGGGAGGGG - Intergenic
920539293 1:206766074-206766096 GGACAACTCAAAGCAGGGAAGGG + Intergenic
921022246 1:211246691-211246713 GGACAACTTGAAGTGGGGAGGGG + Intergenic
921230667 1:213067070-213067092 GGACAACTCGACGTGGGGAGGGG - Intronic
921906507 1:220501103-220501125 GGACAAGTCTAAAAGGGGCAAGG - Intergenic
921926818 1:220717548-220717570 GGACAACTCGAAGCAAGGAAGGG - Intergenic
921927506 1:220723650-220723672 AGACAACTCAAAGCAGGGAAGGG + Intergenic
922057499 1:222055366-222055388 GGACAACTCCAAGTGGTGCAAGG - Intergenic
922811674 1:228418708-228418730 GGACAACTGGAAGTGGGGAGGGG + Intergenic
922913266 1:229234964-229234986 GGACAACTCGAAGTGAGGAGGGG - Intergenic
923245448 1:232126734-232126756 GGACAACTCGAAGCAGGGAGGGG + Intergenic
923469637 1:234279152-234279174 GGACAACTGTAAGTGGGGAGGGG + Intronic
923616692 1:235544296-235544318 AGACAACTCAAAGTGGGGAGGGG + Intergenic
923929059 1:238672541-238672563 AGAAAACTCCAACAGGGAAAAGG + Intergenic
924219846 1:241862785-241862807 GGACAACTCAAAGAGGCAAGAGG - Intronic
924359498 1:243222330-243222352 GGACAGCTCTAAGAGGGAAAGGG + Intronic
924522120 1:244814509-244814531 GGACAACTCCAAGCAAGGAGGGG + Intergenic
1063323463 10:5074106-5074128 GGACAACTTGAAGTGGGGAGGGG - Intronic
1064233752 10:13554215-13554237 GGACAACTCAAAGCTGGGAGTGG - Intergenic
1065156250 10:22873000-22873022 GGACAACTGGAAGAGGAGAGGGG + Intergenic
1065209874 10:23392688-23392710 GGACAACTCAAAGTGGGGAGGGG + Intergenic
1065490892 10:26280438-26280460 GGACAACTCGAACTGGGGAGGGG + Intronic
1066054278 10:31665973-31665995 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1066102903 10:32133672-32133694 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1066217367 10:33300767-33300789 GGACAACTCAAAGCAGGGGAGGG - Intronic
1066221806 10:33342589-33342611 GGCCATCTCCAAGAGGAAAAGGG + Intergenic
1066277207 10:33880806-33880828 AGACAACTCGAAGCGGGGAGGGG - Intergenic
1066365002 10:34768414-34768436 GGACAACTGGAAGTTGGGAAGGG + Intronic
1067523741 10:47026460-47026482 TGGGAACTCCAAGAAGGGAATGG - Intergenic
1068523266 10:58101091-58101113 GGACTACTGCAATGGGGGAAAGG - Intergenic
1069180488 10:65352502-65352524 GGACAACTCAAAGTGGGGATGGG - Intergenic
1069727086 10:70587058-70587080 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1069902425 10:71713737-71713759 GGAAAAGTCCAGGAGGGGGAGGG - Exonic
1069999481 10:72365657-72365679 GGGACACCCCAAGAGGGGAAAGG + Intergenic
1070171881 10:73939180-73939202 GGACAACTCAAAATGGGGAATGG - Intergenic
1070301511 10:75207301-75207323 GGACAACTCGAAGTGGGGAGAGG + Intergenic
1070565130 10:77598299-77598321 TGTCAGCTCCAAGAGGGCAAGGG + Intronic
1070936017 10:80295798-80295820 GGACAACTCGAAGTGGGGAGGGG + Intergenic
1071356156 10:84798423-84798445 GGAGAGCACCGAGAGGGGAAAGG - Intergenic
1071693738 10:87850450-87850472 GGACAACTGCAAGAGAGGGCTGG - Intergenic
1071971736 10:90914968-90914990 AGACAAATCCAAGTGGAGAATGG + Intronic
1072385679 10:94925021-94925043 GGACAACTCAAAGTGGGGAGGGG + Intergenic
1072489714 10:95892599-95892621 GGACAACTCAAAGCTGGGAGGGG + Intronic
1072651854 10:97302202-97302224 GGAGAACTACAAGCTGGGAAAGG + Intergenic
1072881630 10:99234331-99234353 GGACAACCCCAAGAGCTGAGAGG + Intronic
1072973211 10:100035548-100035570 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1073819848 10:107249315-107249337 GGACAACTCAAAGTGGGGGCAGG - Intergenic
1073868780 10:107836866-107836888 GGACAACTAGAAGTGGGGAAGGG + Intergenic
1073888586 10:108070272-108070294 GGAAAACTCCAAGATGGGATGGG + Intergenic
1074026136 10:109637501-109637523 GGACAACTTGAAGTGGGGAGGGG - Intergenic
1074056323 10:109925487-109925509 AAAAAACTTCAAGAGGGGAAAGG - Intergenic
1074954713 10:118377288-118377310 GGTCAACTCCAAGAGTTGATGGG - Intergenic
1075234903 10:120718805-120718827 GGACAACTCAAAGCGGGGGTTGG - Intergenic
1075243809 10:120802120-120802142 GGACAAGTCCAAGTGGAGAGGGG + Intergenic
1075987415 10:126799732-126799754 GGACAATTGCAAGAGAGGGAGGG - Intergenic
1076329928 10:129656666-129656688 GGACAACTCGAAGCAGGGAAGGG + Intronic
1076997515 11:305798-305820 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1077325002 11:1959872-1959894 GGAGATGTCCACGAGGGGAAGGG - Intronic
1077534059 11:3110776-3110798 GGACAACTTCAAGCGGGGAGGGG - Intronic
1077918846 11:6628502-6628524 GGACGACATCAAGAGGGAAAAGG + Intronic
1078517170 11:12032389-12032411 GGAGAAATCAAAGTGGGGAAGGG + Intergenic
1079862970 11:25696759-25696781 GGACAACTCAAAGCAGGAAAGGG + Intergenic
1080343750 11:31297840-31297862 GGGCAACTCGAAGTGGGGATGGG - Intronic
1081287274 11:41286155-41286177 GCACAACTTCAAGAAAGGAATGG + Intronic
1082036958 11:47652764-47652786 GGACAACTCAAACTGGGGAGAGG - Intergenic
1083055642 11:59816490-59816512 GTACAACTCAAAGTGGGGAAGGG + Intergenic
1083105248 11:60351296-60351318 GGACAACTCAAAGCTGGGAGGGG + Intronic
1083239544 11:61377157-61377179 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1085151609 11:74256852-74256874 AGACAAAGCCATGAGGGGAATGG + Intronic
1085678958 11:78552691-78552713 GGAGAACTCGAAGTGGGGAGGGG - Intronic
1085988642 11:81813070-81813092 GGACAACTCCAAGAAAGGGTGGG - Intergenic
1087013124 11:93531942-93531964 GGACAACTCGAAATGGGGCAGGG - Intronic
1087146599 11:94819588-94819610 GGACAACTCCAAGTGGGGGAAGG - Intronic
1087993127 11:104770510-104770532 GGACAACTTGAAGTGGGGAGGGG + Intergenic
1088353263 11:108913271-108913293 GGACAACTCGAAGCAGGGAGGGG + Intronic
1088654609 11:111987280-111987302 ACACAACTTCAAGAGGGAAAGGG + Intronic
1089864134 11:121616948-121616970 GGACAACTCAAAGTGGGCATGGG + Intronic
1090040529 11:123286954-123286976 GCACAACACCAATAGGGGATTGG + Intergenic
1090096060 11:123742539-123742561 GGACAACTCAAAGCGGGGAGGGG + Intergenic
1090096933 11:123751654-123751676 GGACAACTTGAAGTGGGGAGTGG + Intergenic
1202807984 11_KI270721v1_random:15051-15073 GGAGATGTCCACGAGGGGAAGGG - Intergenic
1091757795 12:3066559-3066581 GGACAACTTGAAGACGGGGAGGG - Intergenic
1092317027 12:7427759-7427781 GGATACCTACATGAGGGGAATGG - Intronic
1092753961 12:11745550-11745572 GCACATTCCCAAGAGGGGAATGG - Intronic
1093296895 12:17402397-17402419 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1094468297 12:30778274-30778296 GGACAACTTGAAGCGGGGAGGGG - Intergenic
1095266186 12:40160858-40160880 GGCCAACTCAAAGAGGGGAGGGG + Intergenic
1095268437 12:40187416-40187438 GGACAACTCAAAGAGGGGACAGG + Intergenic
1095269027 12:40194550-40194572 GGACAACTCAAAGTGGGGACAGG + Intergenic
1095897585 12:47295602-47295624 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1096363321 12:51007102-51007124 GGACAACTTGAAGTGGGGAGGGG - Intronic
1097138050 12:56875864-56875886 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1097255099 12:57667468-57667490 GGGCAACTCAAAGCAGGGAAGGG - Intergenic
1097740309 12:63233956-63233978 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1098358222 12:69630768-69630790 GGGCAACTCAAAGTGGGGAGGGG + Intergenic
1098408975 12:70158721-70158743 AGACAACTCAAAGTGGGGAGGGG - Intergenic
1099200155 12:79667003-79667025 GGACAACTTGAAGAGGGGAAGGG - Intronic
1099545191 12:83970472-83970494 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1100008056 12:89918209-89918231 TCACAACTCAAAGAGAGGAAAGG + Intergenic
1100079848 12:90835366-90835388 GAACAACTCAAAGTGGGGAGGGG - Intergenic
1100121419 12:91373377-91373399 GGACAATTCAAAGTGGGGAGGGG - Intergenic
1100180399 12:92079242-92079264 TGGCAACTCCATGAGGGGAGGGG + Intronic
1100522536 12:95389119-95389141 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1100548997 12:95629114-95629136 GGACAACTCTAAGTGCGGAGGGG + Intergenic
1100710614 12:97252352-97252374 GGACAACTCCAAGTGGAGAGGGG - Intergenic
1101694036 12:107107734-107107756 GGGCAACTCGAAGAGGGGAGGGG - Intergenic
1102416548 12:112767633-112767655 GGACAAACCAGAGAGGGGAAGGG - Intronic
1102433665 12:112903300-112903322 GGACAACTCGAAGTGGGGAGGGG + Intergenic
1102444514 12:112991553-112991575 GGACAATTCAAAGTGGGGAGAGG + Intronic
1103211703 12:119171832-119171854 GGACAACTCAAAGCAGGGCAAGG + Intergenic
1104258286 12:127159546-127159568 GGACAACTCAAGGAGAGGAGGGG + Intergenic
1104321609 12:127756737-127756759 GGAGAACTGAAAGTGGGGAAGGG - Intergenic
1104426145 12:128679835-128679857 GGAGAAAACCAAGAGGGTAATGG + Intronic
1104647677 12:130508838-130508860 GGAAATTTCCAAGAGTGGAAAGG + Intronic
1104855843 12:131902168-131902190 GGACAGCTCCCAAAAGGGAAGGG - Intronic
1105812873 13:24010091-24010113 GGACCACTCGAAGTGGGGAGGGG + Intronic
1106293800 13:28391482-28391504 GGACAACTCGAAGTGGGGAGGGG - Intronic
1106397333 13:29393834-29393856 GGACAACTCGAAGTCGGGAGGGG + Intronic
1106542071 13:30699009-30699031 GGACAACTCCAAGTGGAGAGGGG + Intergenic
1106847040 13:33747907-33747929 GGACAACTCAAAGTGGGGAGAGG + Intergenic
1107292197 13:38867650-38867672 GGCCCACTCCAAGAGGCCAAAGG + Intronic
1108379562 13:49843104-49843126 GCACAACTCAAAGTGGGGAGAGG - Intergenic
1108447936 13:50527942-50527964 GGACAGGTCCAGGAGAGGAATGG - Intronic
1109397438 13:61778532-61778554 GGACAACTCGAAGAGGGGAGGGG + Intergenic
1109434128 13:62276070-62276092 GGATAACTCAAAGCGGGGAGGGG + Intergenic
1110124833 13:71929773-71929795 GGACAACTCGAAGTAGGGAGGGG + Intergenic
1110666413 13:78122590-78122612 GGGCAACTCGAAGTGGGGCAGGG + Intergenic
1111015148 13:82370840-82370862 GGACAACTCAAAGTGGTGAGGGG - Intergenic
1111034734 13:82657477-82657499 GGACAATTCAAAGTGGGGAAGGG + Intergenic
1111280324 13:86014439-86014461 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1112447271 13:99475684-99475706 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1113161946 13:107391756-107391778 GGACAACTCAAAGCGGGGGCAGG - Intronic
1113417008 13:110136494-110136516 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1113478495 13:110602767-110602789 AGACAACTCGAAGTGGGGAGGGG - Intergenic
1113626412 13:111851215-111851237 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1113732628 13:112652807-112652829 GGACAACTCGAAGCAGGGAGGGG + Intronic
1115353943 14:32427037-32427059 GGAAATATTCAAGAGGGGAAAGG + Intronic
1115456803 14:33613403-33613425 GGTCAATTCAGAGAGGGGAAGGG - Intronic
1116093225 14:40335250-40335272 GGACAACTTGAAGTGGGGAGGGG + Intergenic
1116173155 14:41428865-41428887 GGACAACTCAAAGCGGGGAAGGG - Intergenic
1117188056 14:53261824-53261846 GGACAACTGGAAGTGGGGAGAGG + Intergenic
1117446249 14:55806265-55806287 AGACAACTCAAAGCGGGGAGGGG + Intergenic
1118510408 14:66465727-66465749 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1118631985 14:67713841-67713863 GGACAACTCGAAGCAGGGAGGGG + Intronic
1119042671 14:71289212-71289234 GGACAACTCCAAGCAGGGAGGGG + Intergenic
1119796282 14:77400555-77400577 GGACAACTTCAAGTGGGGCGGGG + Intronic
1119892278 14:78191863-78191885 ACACAGCTCAAAGAGGGGAAGGG - Intergenic
1120389969 14:83893967-83893989 GGACAACTCAAAGAAGGGAGGGG - Intergenic
1120616010 14:86705778-86705800 GGACAACTTGAAGATGGGAAGGG - Intergenic
1120622263 14:86778528-86778550 GGACAACTCAAAGAGGGGTTGGG + Intergenic
1121602680 14:95217834-95217856 GCACCATCCCAAGAGGGGAAGGG + Intronic
1122265410 14:100544508-100544530 GGACATGTCGAAGAGGGGCAGGG - Intronic
1122434461 14:101684976-101684998 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1122460101 14:101887630-101887652 GGCCACGTCCAAGAGGGGAGAGG + Intronic
1122950380 14:105041331-105041353 GGACAACTCGAAGCAGGGAGTGG + Intergenic
1122953580 14:105059606-105059628 GGACAACTCGAAGCAGGGAGGGG - Intronic
1123146054 14:106131493-106131515 GGACAACTTGAAGTGGGGAGAGG + Intergenic
1123403844 15:20009262-20009284 GGCCATGTCCAAGAGGGGAGTGG + Intergenic
1123513183 15:21015908-21015930 GGCCATGTCCAAGAGGGGAGTGG + Intergenic
1123688667 15:22818909-22818931 GGACTATGCCAAGATGGGAAAGG - Intronic
1124033108 15:26029206-26029228 GGACAACTCCAAGTGGGGAGGGG + Intergenic
1125482033 15:40087743-40087765 TCTCAACTCCAAGAGGGGAAAGG + Intergenic
1126744381 15:51811396-51811418 GCACAACTCTAAAAGGGGGAGGG - Exonic
1129423968 15:75451608-75451630 GGGAAACTCCGAGGGGGGAAGGG + Exonic
1130061561 15:80574237-80574259 AGACAATTCCAACAGGGAAAGGG - Intronic
1130732737 15:86515987-86516009 GGACAACTCAAAGCGGGGGAGGG + Intronic
1130972715 15:88746648-88746670 GGAGAACTCCAAGCGGGGAGGGG - Intergenic
1131193255 15:90334239-90334261 GGACAACTGGAAGCGGGGCATGG + Intergenic
1131416376 15:92262779-92262801 GGACAACTCGAAGCAGGGAGAGG - Intergenic
1132407215 15:101551027-101551049 GGACAACTCGAAGCAGGGAGAGG - Intergenic
1133167968 16:3962060-3962082 GGAAAACCCCTACAGGGGAAGGG + Intronic
1133697795 16:8281413-8281435 GGACAACTTCAAGTGGTGAGGGG + Intergenic
1134181661 16:12052678-12052700 TGAGAACTGAAAGAGGGGAAAGG + Intronic
1134257445 16:12623904-12623926 GGCCAACTCAAAGAAGGGAGGGG - Intergenic
1135265031 16:21017500-21017522 GGACAACTTGAAGTGGGGAGGGG - Intronic
1135323342 16:21511368-21511390 GGACAACTCCAAGGTGGGGATGG - Intergenic
1135988015 16:27198427-27198449 GGACAACTCGAAGGAGGGAAGGG - Intergenic
1136334828 16:29604634-29604656 GGACAACTCCAAGGCAGGGATGG - Intergenic
1136693054 16:32050292-32050314 GGACAACTTGAAGTGGGGAGAGG - Intergenic
1136793548 16:32993518-32993540 GGACAACTTGAAGTGGGGAGAGG - Intergenic
1136876364 16:33860869-33860891 GGACAACTTGAAGTGGGGAGAGG + Intergenic
1138296656 16:55891541-55891563 GGACAACTCAAAGTGGGGAAGGG + Intronic
1138576493 16:57910737-57910759 GGACAACTCAAAGGGAGGAGTGG - Intronic
1138974532 16:62187804-62187826 AGACAACTCAAAAAGGGGAGTGG - Intergenic
1139119559 16:63998907-63998929 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1139314192 16:66054378-66054400 GGACAACTCAAAGAGTGGGGTGG - Intergenic
1140419987 16:74811474-74811496 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1141066596 16:80919029-80919051 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1141116750 16:81315506-81315528 GGACAACTCCAAGGGGCGCGGGG - Intronic
1141214442 16:82010650-82010672 GGACAACTCGAAACGGGGAGGGG - Intronic
1141726462 16:85792475-85792497 GGAGAACTCGAAGGGAGGAACGG + Intronic
1141747478 16:85935456-85935478 GGACAGCTCCAAGCAGGAAAGGG + Intergenic
1141757624 16:86002704-86002726 TCAAAACTCCAAGAGAGGAAGGG - Intergenic
1142035545 16:87860452-87860474 GGACAACTCCAAGGCGGGGATGG - Intronic
1203095810 16_KI270728v1_random:1255208-1255230 GGACAACTTGAAGTGGGGAGAGG - Intergenic
1143156197 17:4838147-4838169 GGAAAATTGCAAAAGGGGAATGG + Intronic
1143637753 17:8176147-8176169 GGACCACTCAGAGATGGGAATGG + Intronic
1146441402 17:32898328-32898350 GGACAACTCAAAGTGGGGAGGGG + Intergenic
1146442046 17:32905742-32905764 GGACAACTCAAAGCGCGGAGGGG + Intergenic
1146623104 17:34415493-34415515 GGACCATTCCAAGGGGAGAAGGG - Intergenic
1146627708 17:34446783-34446805 GGAATACTCAAAGTGGGGAAGGG - Intergenic
1146736627 17:35243745-35243767 GGACACATGCAAGAGGGAAACGG - Intronic
1147418115 17:40308134-40308156 GGAAAACGTCATGAGGGGAAGGG - Intergenic
1147512933 17:41087663-41087685 GGACAACTCAAAGCTGGGAGGGG - Intronic
1147513612 17:41095530-41095552 GGACAACTCTAAGTGGGGAGGGG - Intronic
1147514994 17:41107698-41107720 GGACAACTCGAAGCTGGGAGGGG - Intergenic
1147515716 17:41115820-41115842 GGACAAGTCTAAGCGGGGAGGGG - Intergenic
1149254368 17:54808149-54808171 GGACAACTCAAGGCGGGGAAGGG - Intergenic
1149266605 17:54933909-54933931 GGACAACTCAAAGCAGGGAAGGG + Intronic
1150046891 17:61922688-61922710 GGAAATCTCCCAGAGGAGAAAGG + Intronic
1150956159 17:69862652-69862674 GGACAACTCAAAGTGGGGAGTGG - Intergenic
1151922202 17:77165431-77165453 GGACAACTCGAAGCAGGGAGGGG + Intronic
1152045934 17:77935736-77935758 GGACAACTCAAAGTGGGGCAGGG + Intergenic
1152207817 17:78984532-78984554 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1152656908 17:81524043-81524065 GGCCAACTCGGGGAGGGGAAGGG + Intergenic
1153112709 18:1611556-1611578 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1153526232 18:5997605-5997627 GGACAACTCAAGGTGGGGGAGGG - Intronic
1155954922 18:31948804-31948826 GGACAACTCAAAGTGGGGCAGGG + Intronic
1156241028 18:35254217-35254239 GGACAACTCTAAGAAGCAAAAGG - Exonic
1156516251 18:37683097-37683119 GAACACCTCCAAGGAGGGAAGGG + Intergenic
1157876848 18:51281710-51281732 GGACAACTCCAAGTGGGGTGGGG + Intergenic
1158442504 18:57489334-57489356 GGAAAAATACAAGAGGGAAAAGG + Exonic
1158849469 18:61480486-61480508 GGACAACTCGAAGCAGGGACAGG + Intronic
1158907449 18:62027514-62027536 GGACAACTCAAAGCAGGGAGTGG + Intergenic
1158917725 18:62152097-62152119 GGACAACTCAAAGTGGGGATTGG + Intronic
1159755182 18:72355447-72355469 TGATAACTACTAGAGGGGAAGGG - Intergenic
1159918217 18:74204441-74204463 GGACAACTCAAAGTAGGGAGGGG - Intergenic
1160198431 18:76776743-76776765 GGACAACTCGAAGCTGGGAGGGG + Intergenic
1163327004 19:16611087-16611109 GGACAGGACCAAGAGGGAAATGG + Intronic
1164619087 19:29683091-29683113 GAGCAACTCCAAGATGTGAAGGG + Intergenic
1165124883 19:33586996-33587018 GAACAACTCAAAGTGGGGAGGGG - Intergenic
1165379845 19:35471332-35471354 GGACAATTCAAAGTGGGGCAGGG - Intergenic
1166053498 19:40274963-40274985 GGACAGCTCCTGGAGAGGAAGGG - Intronic
1167200661 19:48062989-48063011 GGACAACTCAAAGCAGGGAGGGG + Intronic
1167750491 19:51376628-51376650 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1168613364 19:57818558-57818580 GGACAACTCCAAGCAGGGAGGGG + Intronic
925040693 2:731462-731484 GGACAACTCCACAAGGGGAGGGG - Intergenic
925734299 2:6947845-6947867 GAACAAATCCAAGAGGGAAGTGG - Intronic
925800221 2:7591742-7591764 GGACAACTCAAAGCGGGGGTCGG + Intergenic
926348366 2:11970676-11970698 GGACAACTCAAACTGGGGAGGGG - Intergenic
927746246 2:25624181-25624203 GGACAACTTGAAGAGGGACAGGG - Intronic
928347422 2:30513817-30513839 GGACAACTCGAAGCAGGGAGGGG - Intronic
928682080 2:33712990-33713012 GGACAACTTGAAGAGGGGCAAGG - Intergenic
928716125 2:34062929-34062951 GGACAACTCAAAGTAGGGAAGGG + Intergenic
928834613 2:35529191-35529213 GGACAACTCAAAGCAGGGAGAGG + Intergenic
930488436 2:52038256-52038278 GGACAACTCGAAGCAGGGAGGGG - Intergenic
930682883 2:54276225-54276247 GGACAATGGCCAGAGGGGAAGGG - Intronic
931200444 2:60092546-60092568 AGTCATCTCCAAGAGGGTAAAGG + Intergenic
932356565 2:71072630-71072652 GCACAACTCCACCTGGGGAAAGG - Exonic
932408112 2:71527501-71527523 GGTGAACTTCAAGAGGGGCATGG + Intronic
932549293 2:72751292-72751314 GGACAATTTGAAGTGGGGAAGGG + Intronic
932727546 2:74192509-74192531 GGACAATTCAAAGTGGGGAGTGG + Intergenic
932800620 2:74739494-74739516 GGACAGCAGGAAGAGGGGAAGGG - Intergenic
933196837 2:79400094-79400116 GGACAACTCAAAGCAGGGAGGGG + Intronic
933512956 2:83264178-83264200 AGACAACTCAAAGCAGGGAAGGG - Intergenic
934016539 2:87891739-87891761 GGACAAGTCAAAGTGGGGAGGGG - Intergenic
934108247 2:88716241-88716263 GGACAACTTGAGGCGGGGAAGGG - Intronic
935024943 2:99268042-99268064 GGACAACTCAAAATGGGGAGGGG - Intronic
936168051 2:110141079-110141101 GCACAAGGCCAAGAGGGGGAAGG - Intronic
936572182 2:113626493-113626515 GGACAACTCGAAGCAGGGAGGGG - Intergenic
936956364 2:118026553-118026575 GGACAACTCAAAGTGGGGAGGGG + Intergenic
937094333 2:119225593-119225615 TGATAAGTCCAAGAAGGGAAGGG - Intronic
937837911 2:126492616-126492638 GGACAACTCAAAGTGGGGGTTGG + Intergenic
938598518 2:132813171-132813193 AGGCAAGTTCAAGAGGGGAATGG + Intronic
938777834 2:134557550-134557572 GGACAACTCAAGGTGGGGAGGGG + Intronic
939235331 2:139485117-139485139 GGACAACTGGAAGAGGGGAGGGG - Intergenic
939535141 2:143418274-143418296 CTACAACTCCAAGAAAGGAAAGG - Intronic
940219734 2:151339410-151339432 GGACAAAACCAAGAAAGGAAAGG + Intergenic
940988333 2:160072349-160072371 GGACAACTCGAAGTGGAGGAGGG + Intergenic
941136320 2:161722499-161722521 TGACACCTCCAAGTGTGGAAGGG - Intronic
943453144 2:188071248-188071270 GGACAACTCAAAGTGGGGAGGGG + Intergenic
945242084 2:207685624-207685646 TGACAACTCAAAGAGAGTAATGG - Intergenic
945429016 2:209742643-209742665 GGAAAACTTCAAGAGGAGATGGG + Intergenic
946359561 2:219210887-219210909 GGACAACACCAGGAGGGGAGGGG + Intronic
946727219 2:222672352-222672374 GGAAATCTCCAAAACGGGAAAGG - Intronic
948086666 2:235256221-235256243 GGACTACTCAAAGCGGGGAATGG + Intergenic
948142759 2:235685934-235685956 GGACCACTCAAAGTGGGGAGGGG + Intronic
948698100 2:239743757-239743779 GGACAACTCAAAGCTGGGATGGG + Intergenic
948955402 2:241286491-241286513 GGAAGACTCCAAGTGGGGAGGGG - Intronic
949028840 2:241778827-241778849 GGAAGACTCCAAGTGGGGAGGGG + Intronic
949029668 2:241787090-241787112 GGACAACTTGAAGCAGGGAAGGG - Intronic
949030302 2:241792970-241792992 GGAAGACTCCAAGTGGGGAGGGG - Intronic
949076584 2:242062906-242062928 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1170659454 20:18322729-18322751 GGACAACTCAAAAACGGGATAGG + Intergenic
1172208948 20:33184245-33184267 GGACAACTCAAAGCAAGGAAGGG + Intergenic
1173638640 20:44583264-44583286 GGAAAACTCCAAGATGGAAAGGG + Intronic
1173897354 20:46561191-46561213 GGACAACTCAAAGAGGGCAGGGG - Intronic
1174095424 20:48085386-48085408 GGACAACTCGAAGCGGGGAGGGG - Intergenic
1175646090 20:60673049-60673071 AGACAACTCGAAGAGGGACAGGG + Intergenic
1177197978 21:17922989-17923011 GGACAACTTCAAGCAGGGAGGGG + Intronic
1177360622 21:20064509-20064531 GGACAACTCGAATAGGGGAGGGG - Intergenic
1177589141 21:23139299-23139321 GGACAACTTGAAGTGGGGAGGGG + Intergenic
1177589663 21:23146040-23146062 GGACAACTCAAAATGGGGAGGGG + Intergenic
1178684011 21:34697276-34697298 GGCCAAAGCCAGGAGGGGAAAGG + Intronic
1179016064 21:37595322-37595344 GGACAACTGGAAGCGGGGAGGGG - Intergenic
1179086528 21:38223087-38223109 GGACAACTCAAAGCAGGGAGGGG + Intronic
1179299746 21:40096224-40096246 GGACAACTCAAAGTGGGGAGGGG - Intronic
1179798736 21:43800641-43800663 GGGCAACTCCAAGGGGAGCAGGG - Intronic
1179957126 21:44747626-44747648 GGACACCTCAAAGTGGGGAGGGG - Intergenic
1181076454 22:20381052-20381074 GGACAACTCGAGGTGGGGAGGGG + Intronic
1181358549 22:22317594-22317616 GGACAACTTGAAGTGGGGAAGGG + Intergenic
1182776818 22:32837488-32837510 AAACCACTCCAAGAGGTGAAAGG + Intronic
1183007707 22:34917036-34917058 GGACAACTGGAAGTGGGGAGGGG - Intergenic
1183500005 22:38173177-38173199 GCACAGCTGCAAGAGGGGGATGG + Intronic
1184395967 22:44240771-44240793 GGACAACTCAAAGTGGGGGAAGG + Intergenic
1185406195 22:50652903-50652925 GGACAACTGGAAGCGGGGAGGGG - Intergenic
1185428010 22:50784387-50784409 GGACAACTCGAAGCAGGGAGGGG + Intergenic
949836667 3:8277720-8277742 GGACAACTCAAAGTGAGGAGGGG - Intergenic
949903474 3:8838929-8838951 GGACAGCTCCAAGCAGGAAAGGG - Intronic
950918711 3:16670853-16670875 GGACAATTTGAAGAGGGGCAGGG - Intergenic
951773324 3:26282655-26282677 GGACAACTTTAAGTGGGGATGGG + Intergenic
952300897 3:32103970-32103992 GGACATCTCAAAGTGGGGGAGGG - Intergenic
953422310 3:42763985-42764007 GGACAACTCCAAGGTTGGGAGGG + Intronic
953747824 3:45588451-45588473 GGACAACTCAAAGAGGGGGGTGG + Intronic
953862976 3:46561204-46561226 GGACTAGCCCAAGAGGGAAAGGG + Intronic
954651491 3:52166846-52166868 GGACAACTCGAAGCAGGGAGGGG - Intergenic
955717651 3:61847334-61847356 GGGAAACTTCAAGAGGGGCATGG + Intronic
956097596 3:65733817-65733839 GGACACTTCCAAGAAGGGAATGG + Intronic
956731434 3:72200231-72200253 GGACAACTCAAAGTGGGGAAGGG + Intergenic
957063121 3:75498446-75498468 AGACAACTCGAAGTGGGGAGGGG - Intergenic
957539679 3:81551589-81551611 GGACAACTGGAAGTGGGGAGGGG - Intronic
957911548 3:86625099-86625121 GGACAACTTGAAGAGGGGAACGG + Intergenic
958038175 3:88194264-88194286 GGACAACTTGAAGCGGGGAGGGG - Intergenic
958457642 3:94351554-94351576 GGAGAACTCAAAGAGGAAAAAGG + Intergenic
959690252 3:109190511-109190533 GGACAACTTGAAGTGGGGGAGGG - Intergenic
959970058 3:112399646-112399668 GGACAACTCCAGGCAAGGAAGGG + Intergenic
960006184 3:112783561-112783583 GGACAACTCAAAGCAGGGAGGGG - Intronic
960227627 3:115185479-115185501 GGATAACTCCAAGAGGGAGCAGG - Intergenic
961322472 3:126085144-126085166 GGAAAACTCAAAGAGGGGGAGGG - Intronic
962120123 3:132552540-132552562 GGACAACTTGAAGCGGGGAGGGG - Intergenic
962369232 3:134806921-134806943 GGACAACTTAAAACGGGGAAGGG + Intronic
963896317 3:150688743-150688765 GGACAACTCAAAGCCGGGAGGGG - Intronic
965333012 3:167400796-167400818 GGCCAACTCCAAGCAGGGAAGGG + Intergenic
965556579 3:170024731-170024753 GGACAACTCAAAGTGGGGCGGGG - Intergenic
968710060 4:2108033-2108055 GGAGAAATCCAACAGAGGAAGGG - Intronic
969007008 4:4028459-4028481 AGACAACTCGAAGTGGGGAGGGG - Intergenic
969049309 4:4361387-4361409 GGACAACTCAAAGTGGGGAGGGG - Intronic
969192435 4:5533165-5533187 GGAGAAATCAATGAGGGGAAAGG + Intergenic
969368358 4:6713892-6713914 GGACAACTTGAAGCGGGGAGGGG + Intergenic
969655153 4:8492820-8492842 GGACAACTCGAAGCAGGGAGGGG - Intronic
969805960 4:9608998-9609020 AGACAACTCAAAGCGGGGGAGGG + Intergenic
970422976 4:15922162-15922184 GGACAACTCAAAGCAGGGAGGGG + Intergenic
970829705 4:20322386-20322408 GGACAACTCGAAGTGGGGAGGGG + Intronic
970971325 4:21987741-21987763 GGACAACTTGAAGCAGGGAAGGG - Intergenic
971875785 4:32306543-32306565 AGACAACTCAAAGAGGGGAGGGG + Intergenic
971913195 4:32823495-32823517 GGACAACTCAAAGTGGAGAGGGG + Intergenic
972179839 4:36449974-36449996 GGGCCACTGGAAGAGGGGAAGGG + Intergenic
972182045 4:36479008-36479030 CCCCAACTCCAAGATGGGAATGG + Intergenic
972980947 4:44700487-44700509 GGACAACTTGAAGAGGGGCGGGG - Exonic
973193559 4:47414378-47414400 GGACAACTTGAAGCAGGGAAAGG + Intronic
973677945 4:53285745-53285767 GGACTTCTCCTTGAGGGGAAAGG + Intronic
975707346 4:77124184-77124206 GGACAACTTGAAGTGGGGAGGGG - Intergenic
976746701 4:88410263-88410285 GGACAACTCAAAGCAGGGAGGGG + Intronic
977042995 4:92037659-92037681 GGACAACTCAAAGCAGGGAGGGG + Intergenic
977411498 4:96671967-96671989 GGACAACTGGAAGTGGGGAGGGG + Intergenic
978356831 4:107884718-107884740 GGACAACTCAAAGTGGGGAGGGG - Intronic
978357528 4:107892670-107892692 GGACAACTCAAAGTGGGGAGAGG + Intronic
978701576 4:111652941-111652963 GGACAACTCAAAGCAGGGAGGGG + Intergenic
978951306 4:114562330-114562352 GGACAACTCAAAGTAGGGAGGGG + Intergenic
979326752 4:119389367-119389389 GAAGAACTCCAAGAGGGTGACGG + Intergenic
979848346 4:125545385-125545407 GGACAACTCAAAGTGGGGAAGGG + Intergenic
980259727 4:130432876-130432898 GGACAACTCAAAGCGGGGAGGGG + Intergenic
980270271 4:130574933-130574955 GGGCAACTTGAAGTGGGGAAGGG + Intergenic
980982710 4:139668083-139668105 GGACAACTGGAAGTGGGGCATGG + Intronic
981118546 4:141020960-141020982 GGACTACTGCAATAGAGGAAAGG + Intronic
981434599 4:144705821-144705843 GGAGAAATGCTAGAGGGGAAAGG - Intronic
983257947 4:165423027-165423049 GGACAACTCGAAGAAGGGAGGGG + Intronic
983378181 4:166956931-166956953 GTACAACTGCAAGAGTGCAAGGG - Intronic
983492263 4:168401382-168401404 GGACAACTCAAAGTTGGGGAGGG - Intronic
983631774 4:169856690-169856712 GGACAACTCAAAGCGGGGAGGGG + Intergenic
983663224 4:170153560-170153582 GGACAACTGGAAGTGGGGAGGGG + Intergenic
983822759 4:172216896-172216918 AGACAACTCTAAGAAGGGAATGG + Intronic
984013428 4:174399285-174399307 GGACAACTCAAAGTGGGGAGGGG + Intergenic
984093216 4:175401772-175401794 GGACAACTCAAAGCGGGGAGGGG - Intergenic
984170380 4:176351352-176351374 GGACAACTTGAAGTGGGGAGGGG + Intergenic
985080936 4:186263214-186263236 GGACAACTCGAAGAAGGGAAGGG - Intergenic
985485456 5:146075-146097 GGAGGACTCCAAGTGGGGAGAGG - Intronic
985891355 5:2717583-2717605 GCACAGCTCAAAGAGGGAAAGGG - Intergenic
986219314 5:5753261-5753283 GGACAACTCGAAGGTGGGAGGGG + Intergenic
987148389 5:15014860-15014882 GGAAAATTTCAAGAGGGGGAGGG - Intergenic
987474085 5:18369336-18369358 GGACAACTTGAAGTGGGGAGGGG - Intergenic
988910830 5:35840646-35840668 GGACAACTCAAAGCAGGGAGGGG + Intergenic
989184063 5:38605829-38605851 GGACAACTCCAAGCGAGGAGAGG - Intronic
990273340 5:54169764-54169786 GGACAACGCCCAGTGGGGAGAGG + Intronic
991773056 5:70057814-70057836 GGACAACTCAAAGTGGGGGTAGG - Intronic
991852349 5:70933238-70933260 GGACAACTCAAAGTGGGGGTAGG - Intronic
992248837 5:74857160-74857182 GGAGAAGGCCAAGAGGGCAAAGG + Intronic
992446618 5:76839863-76839885 GGACAACTTGAAGCGGGGAGGGG - Intergenic
993652835 5:90542827-90542849 GGACAACTTGAAGTGGGGCAGGG + Intronic
993733027 5:91445266-91445288 GGACAACTCAAAGTGGGGAGGGG - Intergenic
993965450 5:94355010-94355032 GGACAATTCGAAGGGGGGCATGG + Intronic
994908579 5:105872319-105872341 GGAGAACTCAAAGTGGGGAGAGG + Intergenic
995311358 5:110716008-110716030 GGACAACTCAAAGCTGGGAGTGG - Intronic
998033323 5:138892032-138892054 GGACAACTCGAAGGAGGGAAGGG - Intronic
998571568 5:143263927-143263949 GGACAACTCCAAGTGGGGAGGGG + Intergenic
999065696 5:148683344-148683366 GAACAATACAAAGAGGGGAACGG + Intergenic
999276993 5:150338128-150338150 GGACACCTCCCCGAGGGCAATGG + Intronic
999359441 5:150970539-150970561 GGACAACTCAAAGTGGGGAGGGG - Intergenic
999747425 5:154603117-154603139 GGCAAAGTCTAAGAGGGGAAAGG - Intergenic
999956682 5:156710607-156710629 GGACAACTCAAAGCAGGTAAAGG + Intronic
1000054510 5:157593083-157593105 ACACAATTCCAAGAGGGAAAAGG + Intergenic
1000193766 5:158938402-158938424 GGACAATTCCCGGAGGAGAAGGG - Intronic
1002703403 5:181143209-181143231 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1003475181 6:6475115-6475137 GGACAACTCAAAGTGGGGAGGGG + Intergenic
1003777342 6:9383163-9383185 GCAAAACTGCAAGAGGAGAATGG + Intergenic
1004289156 6:14350748-14350770 GCACAACCCCAGGAGGGGAAAGG + Intergenic
1004332216 6:14732314-14732336 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1004901419 6:20197632-20197654 GGACAACTCAAAGCAGGGGAGGG - Intronic
1005324276 6:24683686-24683708 GGACAACTCGAAGTAGGGAGGGG + Intronic
1005491867 6:26354581-26354603 GGACAACTCGAAGCTGAGAAAGG + Intergenic
1005935037 6:30514823-30514845 GGACAACTCCAAGTGGCGAGGGG - Intergenic
1006081692 6:31571689-31571711 GGACACTTTCAAGAGTGGAAGGG + Intergenic
1006456787 6:34136632-34136654 GGAGGCCTCCAAGAGGAGAAAGG + Intronic
1006641995 6:35494443-35494465 GCACAACACCAGGAGGGGAGGGG + Intronic
1006965672 6:37981933-37981955 GGACAACTCAAAGTGGGGAGAGG + Intronic
1007012847 6:38434449-38434471 GGACAACTCAAAGCGGGGCTGGG - Intronic
1007769329 6:44180485-44180507 GAGCAACTCCAAGAGGTGAGGGG + Exonic
1008061629 6:47003671-47003693 GGACAACTCGAAGTAGGGACAGG - Intronic
1009361908 6:62825319-62825341 GGAGAACTCGAAGTGGGGATGGG - Intergenic
1009379773 6:63012553-63012575 GGACAACTTGAAGTGGGAAAGGG + Intergenic
1010542488 6:77109161-77109183 GGACAACTCAAAGTAGGGAAGGG - Intergenic
1011559884 6:88603555-88603577 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1011939505 6:92825621-92825643 GGACAACTCCAAGAGAGGAGGGG - Intergenic
1012315379 6:97779011-97779033 GGACAACTTAAAGTGGGGAAAGG - Intergenic
1012825239 6:104139317-104139339 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1012981138 6:105831240-105831262 GGACAGCTGGAGGAGGGGAAGGG + Intergenic
1013304922 6:108838934-108838956 GGGGAACTCCAAGAAGAGAATGG - Intergenic
1013409256 6:109869523-109869545 GGACAACTCAAAGCGGGGAGGGG + Intergenic
1016472472 6:144389156-144389178 GGACAACTCGAAGTGGGGACGGG + Intronic
1017408148 6:154141680-154141702 GGACAACGCGAAGCGGGCAAAGG + Intronic
1017779782 6:157706848-157706870 GGACAACTTGAAGTGGGGAGGGG + Intronic
1018163135 6:161067259-161067281 GGACAACTCGAAGCAGGGATGGG + Intronic
1018551131 6:165000012-165000034 AGGCAACTCCAAGAAGGGAGGGG - Intergenic
1019122951 6:169819383-169819405 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1019123205 6:169821843-169821865 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1019126194 6:169841545-169841567 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1019233445 6:170587666-170587688 GGACAACTCGAAGTGGGGAGGGG + Intergenic
1019760648 7:2810043-2810065 GGTCAACCCCAGGAGGGGAGAGG + Intronic
1021000915 7:15329078-15329100 GGACAACAAAGAGAGGGGAAAGG - Intronic
1021147454 7:17106625-17106647 GGACAACTCAAAATGGGGAGGGG - Intergenic
1021628009 7:22614039-22614061 GACCAAGTTCAAGAGGGGAATGG - Intronic
1021892018 7:25195266-25195288 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1022840669 7:34161083-34161105 GGACAACTCCATTTGGGGCAAGG - Intergenic
1023742734 7:43294984-43295006 GGACAACGCCAAGCAGGGAGGGG + Intronic
1024322445 7:48084647-48084669 GGACAACTCAAAGCGGGGTAGGG - Intergenic
1024599437 7:50966628-50966650 GGACAACTCAAAGTGAGGAGGGG - Intergenic
1024600600 7:50977105-50977127 GGACAACTCAAAGCGGGGAGGGG + Intergenic
1024821583 7:53337093-53337115 GAACAACTCCAAGCAGGGCAGGG - Intergenic
1024995029 7:55267533-55267555 GGACAACTTGAAGTGGGGAGGGG - Intergenic
1025112788 7:56233775-56233797 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1026303600 7:69120683-69120705 GGACAGCTCCAAGTGGGGAGGGG + Intergenic
1026308731 7:69166073-69166095 GGACAACTCAAAGTGGGGGAGGG + Intergenic
1026496639 7:70909239-70909261 GGACAACTCAAAGCGGGGTGTGG + Intergenic
1026795383 7:73363185-73363207 GCACAGCACCGAGAGGGGAAAGG + Intergenic
1027437042 7:78175193-78175215 TGACAACTACAAGAGAAGAAGGG - Intronic
1027733443 7:81903960-81903982 GGACAACTTCAAGAAAGGAGGGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030236783 7:107272331-107272353 GGACAACTCAAAGCGGGGAGGGG - Intronic
1030396301 7:108990810-108990832 GGACAACTCAAAGTGGGGCTTGG + Intergenic
1030585928 7:111419595-111419617 GGACAACTCAAAGCAGGGAGGGG - Intronic
1031227126 7:119053707-119053729 GGACAACTCGAAGGGAGGGAAGG + Intergenic
1031424533 7:121589173-121589195 GGACAACTCGAAGTGGGGTGGGG - Intergenic
1031661309 7:124428546-124428568 TGGGAACTCCAAAAGGGGAAAGG + Intergenic
1032483042 7:132262107-132262129 GGTCAAGTTCAAGAAGGGAAAGG - Intronic
1032700372 7:134373704-134373726 GGACAACTCTAAGCGGGGAAGGG + Intergenic
1032717497 7:134522469-134522491 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1034062242 7:148103011-148103033 GGACAACTCGAAATGGGGAGGGG + Intronic
1034706626 7:153151621-153151643 GGACAACTCTAAGCAGGGAGGGG + Intergenic
1034918222 7:155058362-155058384 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1035072767 7:156157205-156157227 GGACAATGCCAAGAGGAGCAGGG + Intergenic
1036008529 8:4694286-4694308 GGACAACTTCAAGCAGGGAGGGG - Intronic
1036229424 8:6986756-6986778 AAACAACTTCAAGAGGGAAATGG - Intergenic
1036231875 8:7005859-7005881 AAACAACTTCAAGAGGGAAATGG - Intronic
1036324341 8:7768153-7768175 GGAGAAGACCAAGATGGGAATGG + Intergenic
1036455565 8:8903748-8903770 GGACAACTCAAAGCGGGGGTGGG - Intergenic
1036548074 8:9791440-9791462 GGACAACTACAGGTGGGGGAGGG - Intergenic
1037172906 8:15914712-15914734 TTACGATTCCAAGAGGGGAAAGG + Intergenic
1037541261 8:19873782-19873804 GGACAACTTGAAGCAGGGAAGGG - Intergenic
1037759912 8:21734996-21735018 GGACAACTTGAAGCGGGGAGGGG - Intronic
1037965807 8:23133304-23133326 GGACAACTCCAAGCGGGGAGGGG - Intergenic
1038105824 8:24432690-24432712 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1038727003 8:30090569-30090591 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1039714332 8:40091752-40091774 GGACAACTCGAAGCGGGGGCAGG + Intergenic
1040842976 8:51804179-51804201 GGACAACTTGAAGTGGGGAGGGG + Intronic
1041359768 8:57040774-57040796 GGACAACTCAAAGTGGGGGTGGG + Intergenic
1041918361 8:63158252-63158274 GGACAACTTGAAGTGGGGATGGG - Intergenic
1043561103 8:81494313-81494335 GGACAACTCTAAGCAGGGAGGGG + Intergenic
1043577358 8:81673376-81673398 GGACAACTAGAAGTGGGGAAGGG - Intronic
1043676868 8:82967712-82967734 GGACAACTCAAAGTGGGGACGGG + Intergenic
1044007175 8:86952106-86952128 GGACAACTCAAAGTGGGGAGGGG - Intronic
1044309808 8:90680544-90680566 GGACAACTCGAAGCGGGGAGGGG - Intronic
1044659404 8:94580283-94580305 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1046222593 8:111235482-111235504 GGAAAACTCAAAGTGGGGAGGGG - Intergenic
1047100931 8:121675101-121675123 AGACAACTCGAAGCGGGGAGAGG + Intergenic
1047558722 8:125963385-125963407 GGACAACTGGAAGCAGGGAAGGG - Intergenic
1047574886 8:126142091-126142113 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1047951433 8:129939250-129939272 GGACAACGCCGACACGGGAAGGG + Intronic
1048388496 8:133936980-133937002 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1048520140 8:135146227-135146249 GGACAACTCAAAGCAGGGATGGG + Intergenic
1048797505 8:138164662-138164684 GGACAATTCTAAGCGGGGAGGGG - Intronic
1048839572 8:138552927-138552949 GGAGAATTCCAAGAGTGAAAAGG - Intergenic
1049449453 8:142652434-142652456 GGACAACTCAAAGTGGGGCAGGG + Intergenic
1049456203 8:142690979-142691001 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1050545591 9:6706162-6706184 GAACAACTCAAAGAGGGGAGTGG + Intergenic
1050990460 9:12144786-12144808 GGACGACTCGAAGCGGGGAGGGG - Intergenic
1052261795 9:26525284-26525306 GGACAACTCTATCAGGGGAAGGG + Intergenic
1054260267 9:62858340-62858362 GCACAACTACAAGAGCAGAATGG + Intergenic
1055019647 9:71656131-71656153 GGACAACTCAAAGCGGGGAGGGG - Intergenic
1055162002 9:73141876-73141898 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1055462799 9:76535052-76535074 GGACAACTCAAAGCAGGGAGGGG - Intergenic
1055615420 9:78067171-78067193 GGACAACTCGAAGTTGGGAGGGG - Intergenic
1056681958 9:88727122-88727144 GGACAACTTTAAGAGGGAGAGGG + Intergenic
1056889669 9:90479047-90479069 GGACAACTCGAAGCAGGGAGTGG - Intergenic
1057467079 9:95323915-95323937 GGACAACTCGAAGTGGGGAGGGG + Intergenic
1057909558 9:99007076-99007098 GGACAACTCAAAGTAGGGAGGGG + Intronic
1057910255 9:99014824-99014846 GGACAACTCAAAGTGGGGAGGGG + Intronic
1057981502 9:99668535-99668557 GGACATCTCAAAGTGGGGGAGGG + Intergenic
1058384319 9:104415750-104415772 GGACAACTCAAAGCAGGGAAGGG - Intergenic
1058996874 9:110307778-110307800 GGACAACTTGAAGCGGGGAGGGG - Intronic
1058997471 9:110314210-110314232 GGACAACTCAAAGTGGGGAGGGG - Intronic
1059346253 9:113630975-113630997 GGACAACTCCAGGAAGGGTTGGG - Intergenic
1059888171 9:118769795-118769817 GGATGACTCCAAGCGGGGAGCGG + Intergenic
1060314499 9:122496700-122496722 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1060484569 9:124039042-124039064 GGTAAGCTCAAAGAGGGGAAGGG + Intergenic
1060858541 9:126934859-126934881 GGACAGCTCCAAGTGAGGAAGGG - Intronic
1060899943 9:127248378-127248400 GGACTATTTCAACAGGGGAATGG - Intronic
1061455014 9:130691377-130691399 GGACAACTCGAAGCTGGGAAGGG - Intergenic
1062259232 9:135651451-135651473 GGACAACTCGAAGCTGGGAGGGG + Intergenic
1185715113 X:2335372-2335394 GGACGACTCGAAGTGGGGAGGGG + Intronic
1185782871 X:2864325-2864347 GGACAACTCAAAGTGGGGCGGGG + Intronic
1185985010 X:4823145-4823167 GGACAACTCGAACCGGGGAGGGG + Intergenic
1186046386 X:5541344-5541366 GGACAACTCAAAGATGGAAGGGG + Intergenic
1186156206 X:6729322-6729344 GGACAACTCAAAGTGGGGACAGG - Intergenic
1186440315 X:9580374-9580396 GGACAACTCAAAGTGGGGAGGGG + Intronic
1186779696 X:12900257-12900279 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1186783329 X:12935317-12935339 GGACAACTCGAAGCAGGGGAGGG + Intergenic
1186871878 X:13781681-13781703 GGACAACTCGAAGCAGGGAGGGG - Intronic
1187139853 X:16583217-16583239 GGACAACTCAAAGTGCGGAGGGG - Intergenic
1187385640 X:18846073-18846095 GGACAACTCGAAGAGAGGAGGGG + Intergenic
1188285504 X:28321927-28321949 GGACAACTCAAAGCAGGGGAGGG + Intergenic
1188439637 X:30202705-30202727 GGACAACTCAAAGAGCGGGTGGG - Intergenic
1188939542 X:36219749-36219771 GGACAACTCGAAGAGGGGAGGGG - Intergenic
1189085115 X:38014663-38014685 GGACAACTCTAAGCAGGGAGGGG + Intronic
1189279837 X:39813313-39813335 GGACAATTCCAAGTGGGCAGCGG + Intergenic
1190426615 X:50339285-50339307 GGACAACTCGAAGTGGGGAGGGG + Intronic
1190454898 X:50617875-50617897 GACCAACTCCAGAAGGGGAAGGG + Intronic
1190887093 X:54539813-54539835 GGAGACCTCTCAGAGGGGAAGGG - Intronic
1191085438 X:56563176-56563198 GAACACCTCCAGTAGGGGAAGGG - Intergenic
1191845264 X:65542544-65542566 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1191920127 X:66246685-66246707 GAACCTCTCCAACAGGGGAAAGG - Intronic
1192283272 X:69706615-69706637 GGACAACTCGAAGAAGGGTGGGG + Intronic
1193427354 X:81355595-81355617 GGTCAACTCCCAGAAGGAAAGGG - Intergenic
1194044887 X:88990202-88990224 GGACAACTCAAAGTGGGGAGGGG - Intergenic
1194199076 X:90933301-90933323 AGACAACTCAAAGTGGGGAAGGG - Intergenic
1194296640 X:92134000-92134022 GGACAACTTGAAGTGGGGAGGGG + Intronic
1194442501 X:93950267-93950289 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1194492507 X:94569159-94569181 GGACAACTCAAAGCAGGGAGGGG + Intergenic
1195016382 X:100785901-100785923 GGTCAAATCCGATAGGGGAAAGG - Intergenic
1195150249 X:102060565-102060587 GAACAACTCAAAGCAGGGAATGG - Intergenic
1195195823 X:102497255-102497277 GGACAACTCAAAGTGGGGAATGG - Intergenic
1195220657 X:102742976-102742998 GGACAACTCCAAGAGGGGAAGGG + Intronic
1195286409 X:103388929-103388951 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1195487045 X:105421195-105421217 GGACAACTCAAAGTGGGGAGTGG + Intronic
1195487312 X:105424296-105424318 GGACAACTCAAAGTGGAGAATGG + Intronic
1195647828 X:107252725-107252747 GGACAACTCAAAGCGGGGAGGGG - Intergenic
1196884275 X:120228147-120228169 GGACAACTCGAAGCAGGGAGGGG - Intergenic
1196884945 X:120235567-120235589 GGACAACTCGAAGTGGGGAGGGG - Intergenic
1197213813 X:123849668-123849690 GGACAACTTGAAGTGGGGGAGGG - Intergenic
1198306454 X:135388557-135388579 GGACAACTCAAAGTGGGGAAGGG - Intergenic
1198434889 X:136607544-136607566 GGACAACTCAAAGTAGGGCAGGG + Intergenic
1198751336 X:139939064-139939086 GGAAAACTCGAAGTGGGGAGGGG - Intronic
1199127947 X:144146801-144146823 GGACAAGTCAAAGTGGGGAGGGG + Intergenic
1199356595 X:146869643-146869665 GGACAACTCGAAGCAGGGAGGGG + Intergenic
1199887909 X:152040593-152040615 GGACAACTATAAGTGGGGAGGGG + Intergenic
1200159197 X:153996343-153996365 GGACAACTTGAAGTGGGGAGGGG - Intergenic
1200285857 X:154821553-154821575 GGACAACTTGAAGTGGGGAGGGG + Intergenic
1200408230 Y:2836438-2836460 GGGCAACTCAAAGTGGGGAGGGG + Intergenic
1200417346 Y:2926241-2926263 GGACAACTCAAAGCAGGGAGGGG - Intronic
1200545073 Y:4509733-4509755 AGACAACTCAAAGTGGGGAAGGG - Intergenic
1200614154 Y:5358570-5358592 GGACAACTTGAAGTGGGGAGGGG + Intronic
1201672778 Y:16542857-16542879 GGACAACTTGAAGTGGGGAGGGG - Intergenic
1201693733 Y:16799708-16799730 GGACAATTCAAAGTGGGGAGGGG - Intergenic
1202044436 Y:20724272-20724294 GGACAACTCGAAGCAGGAAAGGG + Intergenic
1202050292 Y:20773932-20773954 GGACAACTCAAAGTGGGGTGGGG - Intronic