ID: 1195221249

View in Genome Browser
Species Human (GRCh38)
Location X:102746543-102746565
Sequence CCGGCTCCCCCCGGCCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195221249_1195221262 29 Left 1195221249 X:102746543-102746565 CCGGGAAGGCCGGGGGGAGCCGG 0: 1
1: 0
2: 3
3: 56
4: 332
Right 1195221262 X:102746595-102746617 GGTGGGCCGCGTTCGCTACTCGG 0: 1
1: 0
2: 0
3: 1
4: 9
1195221249_1195221257 12 Left 1195221249 X:102746543-102746565 CCGGGAAGGCCGGGGGGAGCCGG 0: 1
1: 0
2: 3
3: 56
4: 332
Right 1195221257 X:102746578-102746600 GTGCCCAGCCCACGAGAGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 114
1195221249_1195221256 11 Left 1195221249 X:102746543-102746565 CCGGGAAGGCCGGGGGGAGCCGG 0: 1
1: 0
2: 3
3: 56
4: 332
Right 1195221256 X:102746577-102746599 TGTGCCCAGCCCACGAGAGGTGG 0: 1
1: 0
2: 1
3: 35
4: 164
1195221249_1195221255 8 Left 1195221249 X:102746543-102746565 CCGGGAAGGCCGGGGGGAGCCGG 0: 1
1: 0
2: 3
3: 56
4: 332
Right 1195221255 X:102746574-102746596 CTCTGTGCCCAGCCCACGAGAGG 0: 1
1: 0
2: 1
3: 34
4: 375
1195221249_1195221263 30 Left 1195221249 X:102746543-102746565 CCGGGAAGGCCGGGGGGAGCCGG 0: 1
1: 0
2: 3
3: 56
4: 332
Right 1195221263 X:102746596-102746618 GTGGGCCGCGTTCGCTACTCGGG 0: 1
1: 0
2: 2
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195221249 Original CRISPR CCGGCTCCCCCCGGCCTTCC CGG (reversed) Intronic
900203649 1:1421962-1421984 CCCGCTGCCCCAGGCCTTGCTGG - Intergenic
900341842 1:2193353-2193375 CCGGGTCCACCTGGCCATCCTGG - Intronic
900371836 1:2335690-2335712 CCCGCTCCCACCCGCCTGCCAGG - Intronic
900578508 1:3395955-3395977 CCTGCCCGCCCCAGCCTTCCTGG + Intronic
901701510 1:11047015-11047037 CTGGCATCCCCCGGCTTTCCAGG - Exonic
901768900 1:11520730-11520752 CCGGCTCCGCCCCGCCAGCCGGG + Exonic
902624549 1:17668963-17668985 GCGGCTCCCCCAGGCCTGGCTGG - Intronic
903034887 1:20486770-20486792 CCGGCTCCCGCAGGGCCTCCAGG + Intergenic
903185166 1:21624755-21624777 CTGCCTCCCCTCGGGCTTCCTGG - Intronic
903208701 1:21802727-21802749 CAGGCTGTCCCCGGCCTTCTAGG + Intergenic
903220832 1:21868893-21868915 GCAGCTGCCCCGGGCCTTCCTGG - Intronic
903493818 1:23750949-23750971 TCGGCTCCCCGTGGCTTTCCAGG - Exonic
904591546 1:31618037-31618059 CTCGCTCCCCCGCGCCTTCCCGG + Intronic
904604523 1:31691448-31691470 CCTGGGCCCCCCGGCCTCCCTGG - Exonic
905169021 1:36098986-36099008 CCCGGCCCCCCCGGCCTCCCTGG - Exonic
905731839 1:40303582-40303604 CCTGGTCCCCCCGGCCCTCGAGG - Exonic
906214333 1:44030383-44030405 CCGGCCCCTCCCGGCCCTCCGGG + Intronic
907388312 1:54139987-54140009 CCGCCTGCCCCCGGGCTACCAGG - Exonic
910637521 1:89425541-89425563 CCGGCTCTTCCCTGCCTTCAGGG - Intergenic
914237408 1:145824282-145824304 ACGGCTCCCGCTGGCCTTCTAGG - Exonic
914433740 1:147641848-147641870 CCGCCTCCGCCTGCCCTTCCCGG - Intronic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
915585300 1:156840959-156840981 CCCGGGCCCCCCGGCATTCCGGG + Exonic
919764019 1:201114906-201114928 CCCGCTTCCCGCGGCCTCCCGGG - Exonic
920556730 1:206909653-206909675 CCCGCTGCGCCCGGCTTTCCCGG + Intronic
920571606 1:207022164-207022186 TCGGCCCCGCCCGGCCTCCCTGG - Exonic
920609177 1:207421090-207421112 CCGGCTCTGCCCTGCCTTTCGGG + Intergenic
920886972 1:209938476-209938498 CTCGCTCGCCCCGGCCTTCGTGG + Intronic
922193464 1:223339820-223339842 CCGGCTCCCCCAGGACTGGCTGG + Intronic
922539391 1:226407730-226407752 CCGCCCTCCCCCAGCCTTCCCGG + Intronic
923063908 1:230500842-230500864 ACGGCTCCCACCTGCCTCCCGGG - Intergenic
923171479 1:231421589-231421611 CCGGCGCGCCGCTGCCTTCCTGG + Exonic
923622413 1:235589343-235589365 CCGACTCTCCCCTGCCTTCGGGG - Intronic
923789507 1:237100023-237100045 AAGGCTCCCTCCTGCCTTCCAGG + Intronic
1063030040 10:2225458-2225480 CCGACTCCTCCCTGCCTTGCCGG - Intergenic
1063413721 10:5856552-5856574 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1064138581 10:12771364-12771386 CCGGCTCTCCTCAGCCTGCCTGG - Intronic
1064230754 10:13528363-13528385 CCGGAGCCCCCGGTCCTTCCCGG - Intronic
1065025230 10:21534540-21534562 CCGGCGCCCCCCGCCCGGCCCGG - Intronic
1065045001 10:21739232-21739254 CTGGCTCCCTCCACCCTTCCCGG + Intronic
1068589879 10:58842644-58842666 CCGGATCTCCTCGGCCTTCTAGG + Intergenic
1070281349 10:75051098-75051120 CCTGCTCTCCTAGGCCTTCCAGG - Intronic
1072591384 10:96831950-96831972 ACGGCTGCCCCCGCCCTCCCCGG - Intergenic
1075264642 10:120990134-120990156 CCCGCTCCCCCCTCCCCTCCTGG + Intergenic
1075871472 10:125774751-125774773 GACGCTCCCCCCGGCCTTGCGGG + Intronic
1075999729 10:126905333-126905355 CCGCCTCCCGCCGGCGCTCCCGG + Intergenic
1076863233 10:133152598-133152620 CCGGCTCATCCCGGCATTCGTGG - Intergenic
1077104240 11:835055-835077 CCCGCTCCCCACGGCATTCCCGG - Intronic
1077183727 11:1227461-1227483 CCGCCCCCTCCCGGCCTCCCCGG - Intronic
1077244165 11:1527915-1527937 CCGGCTCTCCCTGGCCCTCTGGG + Intergenic
1078986712 11:16605198-16605220 CCGGCGCCCTCCGTCCTTCTCGG - Intronic
1080315049 11:30938426-30938448 CTGGCTCTCCCCTGCCTTCAGGG + Intronic
1080606529 11:33869272-33869294 CCGGGTCCCCCCGACGCTCCGGG + Intronic
1080791433 11:35525636-35525658 CCGCCTGCCCCCGGCCTCCCTGG - Intronic
1081017817 11:37905907-37905929 CTGGCTCTCCCCTGCCTTCAAGG + Intergenic
1081018196 11:37908394-37908416 CCGGCTCTCCCCTGCCATCAGGG + Intergenic
1081498825 11:43645001-43645023 CCAGCTCCCCCAGGCTTCCCTGG + Intronic
1083571792 11:63765145-63765167 CCTGCTGCCCCCGGCCCTCCGGG + Exonic
1083672150 11:64305669-64305691 CCGGCTCACTCCGGCACTCCGGG + Intronic
1084564757 11:69922475-69922497 CCCACTCCCCTGGGCCTTCCTGG - Intergenic
1085316932 11:75550960-75550982 CCTGCTCCCCAGAGCCTTCCCGG + Intergenic
1086584428 11:88434496-88434518 CTGGCTCCCCCTTGCCTTCACGG + Intergenic
1087105258 11:94401547-94401569 CTGGCTCCCCCCACCCTACCGGG + Intergenic
1089560322 11:119340291-119340313 CCGGGGCACCCCGGCCTTCCAGG - Exonic
1090249298 11:125240214-125240236 CCGGCTCCACTCGGCCTCCTTGG - Intronic
1091826807 12:3519013-3519035 CCGGCTCTCCCCTGCCTTCAGGG - Intronic
1092462568 12:8698637-8698659 CCGACTCCAGCCGGCGTTCCCGG - Intronic
1095942762 12:47737506-47737528 CCGGCACACCCTGGCTTTCCCGG + Exonic
1096106936 12:49001522-49001544 CCAGCTCACCCCAGCCTTGCAGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1099093306 12:78340350-78340372 CTGGCTCTCCCCTGCCTTCAGGG + Intergenic
1102068174 12:109996131-109996153 CCCGCTCCCCTCTGCTTTCCTGG - Intronic
1103308890 12:119989206-119989228 CCGGCTCCTCCCGGCTCACCGGG - Intergenic
1103362388 12:120361793-120361815 CCGGCTCCCCCTGGCCTCCCCGG + Intronic
1103450625 12:121026104-121026126 CCGGCTCCCCTCTGCCTCCCAGG - Intronic
1103948406 12:124539471-124539493 CCGGGTTCCCCCAGCCTGCCTGG - Intronic
1103954138 12:124567264-124567286 GCGCCTCCCCCCGCCCTTCGCGG + Intronic
1104669189 12:130668716-130668738 CCGGCTCTCCCCTGCCCTCAGGG + Intronic
1104889274 12:132132573-132132595 CCGCAACCCCCAGGCCTTCCTGG + Intergenic
1105594744 13:21826924-21826946 CCTCCTCCCCCCAGCATTCCAGG - Intergenic
1105843200 13:24273040-24273062 ACGGCTCCTCCCGTCCATCCTGG - Intronic
1107984545 13:45764233-45764255 CCTGCTCTTCACGGCCTTCCTGG + Intergenic
1108063415 13:46553916-46553938 CCGGCGCACCCCTGCCCTCCTGG - Intronic
1109903946 13:68813337-68813359 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1111445279 13:88339519-88339541 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1113426034 13:110209408-110209430 CAGGGTCCCCCAGGCCCTCCCGG - Exonic
1113746153 13:112746350-112746372 CCGGCTCCCCACGTCCTCCCCGG + Intronic
1113746179 13:112746420-112746442 CCGGCTCCCCGCGTCCTCCCCGG + Intronic
1113914827 13:113863949-113863971 GCGGCTCGCCTCGGCCTCCCGGG - Exonic
1114194953 14:20469215-20469237 CCGGCTCCCCCCGCCCGCCCCGG + Intronic
1114422729 14:22598222-22598244 CTTGCTCCCCGCGGCCTCCCGGG + Exonic
1114491666 14:23106200-23106222 CCGGCCTCCCCCGGCCTGCCTGG + Intergenic
1115641046 14:35335799-35335821 CCTGCTCCAGCCGGCCTTCCCGG + Intergenic
1115707738 14:36015360-36015382 CCAGCTCCCCCTGGCCTTCAGGG + Intergenic
1116821999 14:49635065-49635087 GCGGCTCACCTCCGCCTTCCAGG - Exonic
1119418848 14:74494047-74494069 CAGGCTCCTCACGGCCTCCCTGG + Exonic
1119622105 14:76138926-76138948 CAGGCTCCCCCAGGCCTCGCCGG + Intergenic
1121411425 14:93751054-93751076 GCAGCTCCCCCGAGCCTTCCAGG - Intronic
1122295891 14:100705566-100705588 CCGGATCCCTCCCTCCTTCCTGG + Intergenic
1122419319 14:101565110-101565132 CCTGCGCCCCCTGGGCTTCCTGG + Intergenic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1122603674 14:102933726-102933748 CCGGCTGCTCCAGGCCTTCGAGG + Exonic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1122940365 14:104978422-104978444 CCGGCTCCGCCCAGCCCTGCCGG + Intergenic
1124577300 15:30921215-30921237 CCGCCACCCCCAGGCCATCCTGG - Intronic
1125834198 15:42736302-42736324 TCGGTTCCCCCCGGCCCTACAGG - Exonic
1127735551 15:61835521-61835543 CAGGCTACCCCCCGACTTCCTGG - Intergenic
1128726454 15:69991712-69991734 CTGGCTCCCCAGGGCCTTTCAGG + Intergenic
1129483036 15:75843160-75843182 CCGGCTCCTCCCCGACTTCTGGG + Intergenic
1130517166 15:84634142-84634164 CCGGCGCCTCGCTGCCTTCCTGG - Intergenic
1130551584 15:84893065-84893087 CCAGACCCCCCCAGCCTTCCTGG + Intronic
1131143638 15:89998306-89998328 CCTGCTCCCAGGGGCCTTCCTGG + Intergenic
1132309905 15:100849807-100849829 CCGGGTCCTCCCGCCCTTCGCGG + Intergenic
1132623644 16:879843-879865 CAGGATCCCCCCGGCCCGCCTGG + Intronic
1132809846 16:1792308-1792330 TCGGCTTCCCCCGGCGTTCCGGG + Exonic
1132889343 16:2196328-2196350 CCGGCACTCACTGGCCTTCCCGG + Exonic
1133014525 16:2933344-2933366 CCTGCTGCCGCCGGGCTTCCAGG - Exonic
1134134249 16:11668864-11668886 CCGCCTTCCCCCGGCATTTCGGG + Intronic
1134482258 16:14630047-14630069 CCGGCTGCCCCTGGCCTGCTAGG - Intronic
1136014043 16:27383597-27383619 CAGCCTCCCCCCAGCCCTCCAGG + Intergenic
1136402278 16:30025194-30025216 CCGGCCGCCCCCGGCCTGCCAGG - Exonic
1136505173 16:30698543-30698565 CCGCCTCCCCCCCACCTTCCCGG + Intronic
1136515997 16:30768615-30768637 CTGGCTCTCCTGGGCCTTCCTGG - Exonic
1136578954 16:31140609-31140631 CAGGCCCCCCCTGGCCCTCCTGG - Exonic
1138379533 16:56590432-56590454 CCGCCTCCCCACGGCTTTCCTGG + Intronic
1138429711 16:56960929-56960951 CCGGCTCCCCACGTGCTTCTGGG + Intergenic
1138549528 16:57739971-57739993 CTCGCTCCCCCTGGCCTACCTGG - Intronic
1139442186 16:66973898-66973920 CCGGGTCCTCCCTCCCTTCCTGG + Exonic
1140097152 16:71884428-71884450 TCAGCTCCCCCAGACCTTCCTGG + Intronic
1140515082 16:75535619-75535641 CTGGCTCCCGCCGGCCACCCTGG - Intronic
1140557560 16:75939077-75939099 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1141227199 16:82129167-82129189 CGGGCTCACCTCAGCCTTCCAGG - Intergenic
1141733246 16:85836092-85836114 CAGGCTCCCCCTGGCCTTTCTGG + Intergenic
1141805549 16:86339045-86339067 CTGGCTGCCCCCAGTCTTCCAGG + Intergenic
1142132435 16:88437204-88437226 CGGGCTCCCGGCGGCCTTGCCGG - Exonic
1142349950 16:89575407-89575429 CCAGATCCCCGCGCCCTTCCCGG - Intergenic
1144930936 17:18858258-18858280 CTGGCTCCCGCCCGCCTACCTGG - Exonic
1144948230 17:18980667-18980689 CAGGCTCGCCCTGTCCTTCCTGG - Intronic
1145255128 17:21318192-21318214 CCGGCTCCTCCTGGTCTTGCGGG - Intergenic
1145321478 17:21769763-21769785 CCGGCTCCTCCTGGTCTTGCGGG + Intergenic
1147145496 17:38482286-38482308 CCGCCTGCCCCGGGCCTCCCAGG + Intronic
1147340664 17:39751709-39751731 CCGGCTCCCACCGGCCACGCTGG - Intergenic
1147359259 17:39920998-39921020 CCCCCTCCCCTCAGCCTTCCAGG + Intergenic
1147383722 17:40070211-40070233 CCGTCTCCCCCATGCCTGCCAGG + Intronic
1148086855 17:44998745-44998767 CCAGCTCCCCTCTGCCTTACTGG - Intergenic
1148106154 17:45120114-45120136 CCGGCTCCCCACTCCCTTCCTGG + Intronic
1148793591 17:50186903-50186925 CAGGGTCCCCCCGGCCCTCCTGG - Exonic
1148794449 17:50190343-50190365 CCTGGTCCCCCCGGCCCTGCTGG - Exonic
1149430663 17:56593905-56593927 CCGGCTCCTCGCTGCCTTCCCGG - Exonic
1151025054 17:70668743-70668765 CCGGCTCTCCCTTGCCTTCCGGG - Intergenic
1151379033 17:73712151-73712173 CTGGCTCCCGCCAGCCTTCCAGG + Intergenic
1151823871 17:76512779-76512801 CGGGCTCCCCACGGCCTCCCCGG - Intergenic
1152078957 17:78174817-78174839 ACGGCTTCCCCTGGCTTTCCTGG + Exonic
1152561944 17:81083034-81083056 CCGGGTCCTCTCGCCCTTCCAGG - Intronic
1152564814 17:81095631-81095653 TCAGCTCCCCCCGTCCTTCGGGG + Intronic
1152690059 17:81713865-81713887 CTGGCTCCTCCCGCCCTCCCAGG - Intronic
1152703876 17:81833121-81833143 CCGGCCCCGCCCGGCCCTGCAGG + Intronic
1154200121 18:12293885-12293907 CTGGCTCCCCCTGCCCATCCTGG + Intergenic
1155003051 18:21704858-21704880 CCCGCTCCGCCCCGGCTTCCTGG + Intergenic
1157384109 18:47247650-47247672 CCTGCTGCGCCAGGCCTTCCTGG - Intronic
1157867129 18:51197025-51197047 CGGGCTCCGCCCGGCCGGCCCGG - Exonic
1158680441 18:59561780-59561802 CCGGCTCTCCCTTGCCTTCAGGG - Intronic
1158976566 18:62715933-62715955 CCGGCACCCCCCGCTCTGCCCGG - Exonic
1159609919 18:70513697-70513719 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1160025543 18:75212156-75212178 CCGGCCTCCCCCGGCCATCCGGG - Intronic
1160242051 18:77131822-77131844 CCGGCCCGCCCGGGTCTTCCCGG - Intronic
1160501252 18:79402001-79402023 CTGGGTCTCCCCGGCCTCCCAGG + Intronic
1160511178 18:79454418-79454440 CCAGCTTCTCCCAGCCTTCCAGG - Intronic
1160537745 18:79604013-79604035 CCGGCTCCCTGAGGCTTTCCTGG + Intergenic
1161015143 19:1979640-1979662 CCGGCACCCCCCCACCTACCAGG - Exonic
1161216139 19:3095823-3095845 CCGGCTCCTCCCCACCGTCCTGG + Intronic
1161393627 19:4033595-4033617 CCGGCTCCGGCCGCCCTCCCCGG - Intronic
1161577023 19:5060010-5060032 CCTCCTCCCCACAGCCTTCCAGG + Intronic
1161773351 19:6243246-6243268 CCGGCCTCCCCGAGCCTTCCCGG - Intronic
1161788107 19:6340761-6340783 CCGGCTCCCACCCACCTTCCTGG - Intergenic
1161959541 19:7516181-7516203 CCGGCTCCCCCCGGGCCCGCAGG - Exonic
1162339936 19:10086290-10086312 CCGGCTCCGCCCTTCCTCCCCGG - Exonic
1163414558 19:17178189-17178211 CCTGCTCTCCCCAGCCCTCCAGG - Intronic
1163632680 19:18425286-18425308 CCCGCTGCCCCCGCCCTCCCGGG + Intronic
1164624132 19:29715285-29715307 CCGGCTGCGCCGGGCCTTCCGGG + Intronic
1165100663 19:33436732-33436754 CCTGCCCACCCCTGCCTTCCGGG + Intronic
1165109984 19:33496738-33496760 CCGGCAGCCCCCGGCCTCTCTGG + Intronic
1165420060 19:35718079-35718101 CCGGCGCCCCGCGGCCGGCCCGG - Exonic
1165453002 19:35896099-35896121 CCCGCTCCACACGGCCATCCTGG - Exonic
1165993751 19:39830732-39830754 GAGGCTGCCCCTGGCCTTCCGGG - Exonic
1166714135 19:44955618-44955640 CCGGCACCGTCCGGCCTCCCGGG - Intronic
1167035861 19:46994629-46994651 CCGGCTCCTCGAGGCCTTCCTGG - Intronic
1167074301 19:47239669-47239691 CCCGCGCCCCCCCTCCTTCCCGG + Intergenic
1167109995 19:47454599-47454621 CCTGCCCACCCCAGCCTTCCTGG - Intronic
1167246056 19:48373810-48373832 CTGGCTCCCCAGGGCCTCCCGGG + Intronic
1167477760 19:49710773-49710795 CCGTCTCCGTCCGGCCTTCCAGG - Exonic
925747252 2:7054063-7054085 CCGGCTCTCCCCTGCCTTCAGGG - Intronic
925747260 2:7054096-7054118 CTGGCTCTCCCCTGCCTTCAGGG - Intronic
926094407 2:10071807-10071829 CCGGTTCCCCACGTCCGTCCAGG - Intronic
926095613 2:10079600-10079622 GCGGCCCCGCCTGGCCTTCCCGG - Intronic
926225128 2:10961729-10961751 CCGCCTCCCCTCCGCCTCCCAGG + Intergenic
927256649 2:21045217-21045239 CCGCCTCCCACTCGCCTTCCTGG - Intergenic
927501139 2:23584152-23584174 CAGGCTCCAGCCGGCCTCCCAGG + Intronic
927714036 2:25341410-25341432 CCGGGCCGCCCCCGCCTTCCGGG - Intronic
928177201 2:29042666-29042688 CCGGCTCTCCCTTGCCTTCAGGG + Intronic
929125052 2:38515783-38515805 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
930107886 2:47654409-47654431 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
931671775 2:64654011-64654033 CCGCCTCTCCCCGGCGGTCCCGG + Intronic
932446564 2:71785486-71785508 GCGGCTCCCCTCAGTCTTCCAGG + Intergenic
933893272 2:86789838-86789860 ACGCCTCCCCCCGGTTTTCCTGG + Intronic
934566926 2:95346457-95346479 CCGGCTCCCTCCGCCCTTCCCGG + Intronic
934717495 2:96552112-96552134 CCTGGTCATCCCGGCCTTCCCGG + Exonic
934993391 2:98936522-98936544 CCGGTGCCCCCCGGCCCTCCCGG - Intergenic
936076220 2:109403472-109403494 CCAGCCCTCCCTGGCCTTCCAGG + Intronic
936713574 2:115161293-115161315 CGGGCTGCCCCCTGCCTTCTGGG + Intronic
937312107 2:120908824-120908846 CTGGCTCCCCCCTTCCTTTCTGG - Intronic
937466780 2:122139776-122139798 CCAGCTCCCACCCGCTTTCCAGG - Intergenic
941112113 2:161427167-161427189 CCGGCACCCCCCTGGCTCCCCGG - Intronic
947636067 2:231681250-231681272 CCCGCTCCCCTCTGCCTTCCCGG + Intergenic
947742488 2:232491006-232491028 CCCACACCCCCCGGCCCTCCTGG + Intergenic
948347204 2:237308515-237308537 CCCACTCCACCCGGCCTCCCTGG + Intergenic
948903208 2:240966388-240966410 CCCGCTCCCGCTGGGCTTCCCGG - Intronic
949030845 2:241796640-241796662 CCTGCTCCCCCCGGCCATCAGGG - Intronic
949076833 2:242064913-242064935 ACGGCTCCCCCCAGCCCTTCAGG + Intergenic
949078107 2:242074238-242074260 CCAGCCCCCTCTGGCCTTCCAGG + Intergenic
1168830979 20:845183-845205 CCGGCTCCCTCGGCCCGTCCAGG - Exonic
1169020586 20:2328041-2328063 CCGATTCCCCAGGGCCTTCCAGG - Intronic
1169077191 20:2768452-2768474 GCTGCTCCCCAGGGCCTTCCTGG + Intergenic
1171036298 20:21714989-21715011 CCGGCTTTCCCCGACCTTCCAGG + Exonic
1171977429 20:31604426-31604448 CAGTCTCCCCCCTCCCTTCCCGG - Intergenic
1172044619 20:32071545-32071567 CTGGCTCCCACTGGCCTTCCCGG - Intronic
1172105911 20:32517282-32517304 CCCGCTCCCTCCCACCTTCCTGG + Intronic
1172296020 20:33811690-33811712 CGGGCTCCCCCCAGGCTCCCCGG + Intronic
1173573897 20:44097619-44097641 CCGGCTCTCCCTTGCCTTCAGGG + Intergenic
1173963549 20:47093521-47093543 CCGGCTCTCCCTTGCCTTCAGGG + Intronic
1174149898 20:48478548-48478570 CCGGCTCCCCCTCCCCTCCCCGG + Intergenic
1174266851 20:49338168-49338190 CCTGCTCCGCCAGTCCTTCCTGG - Intergenic
1174804736 20:53594630-53594652 CCCCCTCCCTCCGGCCTCCCCGG - Intronic
1175268021 20:57714279-57714301 CCTGCCACCCCCGGCCTGCCTGG + Intergenic
1175943346 20:62547867-62547889 CAGGCTCACCCCGCCCTTGCGGG - Intergenic
1176056526 20:63151833-63151855 CCGGCTCCCTCTGGCTCTCCAGG - Intergenic
1176550087 21:8217180-8217202 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1176569014 21:8400215-8400237 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1176576928 21:8444450-8444472 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1178561582 21:33643125-33643147 TCGCCTCCCGCCGGCCTCCCGGG + Intronic
1178734376 21:35135679-35135701 ACAGCTCCCCCCGGCCCACCAGG - Intronic
1180079626 21:45480793-45480815 CCAGGACCCGCCGGCCTTCCTGG + Exonic
1181174978 22:21030190-21030212 CGGGCTCCTCACGGCCTTCCTGG - Exonic
1181521843 22:23452746-23452768 CCTGCTCCCACTGGCCTTCCTGG - Intergenic
1181580465 22:23825160-23825182 CCCGCTCCTCGCGGCCTCCCTGG + Intronic
1181670917 22:24425117-24425139 CCGGCTCCCCCTGGGTTCCCCGG + Intronic
1181964191 22:26645246-26645268 CAGGCTCCTCGCGGCCTCCCTGG - Intergenic
1182294918 22:29307005-29307027 CCGTCTCCGCCCCGCCTCCCTGG - Exonic
1182522563 22:30892595-30892617 CCGGCCCTCCCCTGCCTTGCTGG - Intronic
1182575439 22:31269913-31269935 CTGACTCCACCCGGCCTCCCAGG - Intronic
1182662674 22:31936121-31936143 CCTGCTGCCCCAGGCCTTCAGGG + Intronic
1183063879 22:35350753-35350775 CAGGGTCCCCCTGGCGTTCCTGG + Intergenic
1183342119 22:37287216-37287238 CTGGCTCCCACCTGCCTTCAGGG - Intronic
1184182660 22:42841202-42841224 CTGGCTCCTCTCGTCCTTCCTGG + Intronic
1185218702 22:49618048-49618070 CTGCCTGCCCCCTGCCTTCCCGG + Intronic
1185282876 22:49983213-49983235 CCGGCTCCCTCCAGACTCCCGGG + Intergenic
1185291692 22:50030679-50030701 GGGGCTCCCCCTGGCCTTGCTGG - Exonic
1203254977 22_KI270733v1_random:133506-133528 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1203263033 22_KI270733v1_random:178585-178607 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
950483547 3:13259526-13259548 CCGACTCCCCAAGGCCTTCGAGG + Intergenic
950578397 3:13846872-13846894 CCGGCTGCCCACGTCCATCCAGG + Intronic
950591257 3:13937012-13937034 CCAGCTGCCACAGGCCTTCCAGG + Intergenic
950712311 3:14821122-14821144 CCAGCTACCACGGGCCTTCCAGG + Exonic
951231580 3:20185980-20186002 CCACCTCCCCCCGGCCTTCCTGG - Intronic
952258537 3:31716444-31716466 CCTGCTCCCCGAGGCCCTCCAGG + Intronic
952744538 3:36764551-36764573 CCGGCCCCGCCCGGCCTCCAGGG - Intergenic
953699466 3:45184627-45184649 TCAGCTCCCCTCTGCCTTCCAGG + Intergenic
953906288 3:46869934-46869956 CCGGCTCCCCTGGGCCATCACGG + Intronic
954710549 3:52503253-52503275 CCTGCTGGCCCCGGCCTTCCTGG + Intronic
955972036 3:64445577-64445599 CCGGCATCCCCCCGCCCTCCCGG + Intergenic
958777440 3:98503219-98503241 CCAGCTGCCCCTGGTCTTCCAGG - Intronic
958892187 3:99794925-99794947 CCAGGACCCCCAGGCCTTCCAGG + Exonic
960089460 3:113624686-113624708 CCCTCTCCCCCCACCCTTCCTGG + Intronic
960971550 3:123143487-123143509 CCGGCTCCCCTGGGGCTGCCAGG + Intronic
961522958 3:127478562-127478584 TCCGCTCCCCACGGCCTACCTGG - Intergenic
962969594 3:140386569-140386591 CCAGCTCTCCCCTGCCTTCAGGG + Intronic
963827590 3:149971241-149971263 CAGTCTCCCCCCGCCCTTCCCGG - Intronic
966872324 3:184299130-184299152 CCGGCTCGCCCCGGCGTTTCCGG + Exonic
967858211 3:194134145-194134167 CCGCCTCCCTCCCGCCTGCCCGG - Intergenic
967867846 3:194204597-194204619 CCGGCCCCCGCCGCCCCTCCCGG + Intergenic
968085725 3:195873107-195873129 GAGGCTCCCGCAGGCCTTCCGGG - Intronic
968519647 4:1029696-1029718 CCGCCCCCGCCCGGCCCTCCTGG + Intergenic
968957048 4:3724905-3724927 CTGGCACCTGCCGGCCTTCCTGG + Intergenic
969636189 4:8370579-8370601 CCCACTCCCCCCGGCCTCCCCGG - Intronic
970597641 4:17614706-17614728 CAGGCCCCGCCGGGCCTTCCGGG + Exonic
972496451 4:39639037-39639059 CAGGCTCCCGCCCGGCTTCCCGG - Exonic
972503334 4:39697937-39697959 CCGGCCCCCCCGGCCCTTCCCGG - Intergenic
973926419 4:55743087-55743109 CTGGCTCTCCCCTGCCTTCGGGG - Intergenic
974079106 4:57194626-57194648 CCCACGCCACCCGGCCTTCCTGG - Intergenic
976027745 4:80711208-80711230 CCGGCTCTCCCCTGCTTTCAGGG - Intronic
979438403 4:120722053-120722075 CCGGCTCTCCCTTGCCTTCAGGG - Intronic
982564637 4:156971812-156971834 CCGGATCCTCCCGGCCGCCCCGG - Intergenic
985494910 5:199000-199022 CAGGCCCACCCCGGCTTTCCAGG + Exonic
985882909 5:2654023-2654045 CCGGGTCCCCCTCGTCTTCCAGG + Intergenic
986094859 5:4544512-4544534 CGGGCTCTACCCGGCATTCCAGG - Intergenic
989637933 5:43556598-43556620 CCAGCCCCCAGCGGCCTTCCCGG - Exonic
998003044 5:138639685-138639707 CCTGCTCCCCCCTCCCTACCAGG + Intronic
998018796 5:138753269-138753291 CCCGCTCCTCCCGGCCGTTCCGG - Intronic
998018822 5:138753339-138753361 CCGGCCCCGCCCGCCCTTCCTGG - Intronic
998132850 5:139659902-139659924 GCGCCTCCTCCCTGCCTTCCCGG - Intronic
998792577 5:145781064-145781086 CCTCCTCCCCACCGCCTTCCTGG + Intronic
999432885 5:151539041-151539063 CAGGCTCACCCTGGCCCTCCCGG - Intronic
1005322239 6:24666823-24666845 CCGCCTCCCTCCCGCCCTCCAGG + Exonic
1005562938 6:27059969-27059991 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1005661511 6:28003373-28003395 CCTGCTCTCCCCTGCCTTCAGGG - Intergenic
1005826173 6:29632872-29632894 CCGGCTCTCCCCGGGCCTCAAGG + Exonic
1006389954 6:33752367-33752389 CAGGCTGCCACCTGCCTTCCAGG + Intergenic
1007078998 6:39085474-39085496 ACGGCAACCCCCAGCCTTCCTGG - Intronic
1007390281 6:41546624-41546646 CCGGCTCCGCTCTTCCTTCCCGG - Exonic
1007829023 6:44624379-44624401 CCGGCTCTCCCTGGCCTTGGGGG - Intergenic
1009935749 6:70232672-70232694 CCTGGTCCCCCCGGCCCTCCTGG - Exonic
1011156648 6:84340918-84340940 CCGGCTCTCCCCAGCTTCCCTGG - Intergenic
1011734486 6:90297191-90297213 CCCGCTCGGCCTGGCCTTCCCGG + Intergenic
1012410223 6:98947977-98947999 CCGGCTCCGCCCCGCCTCCCCGG - Intronic
1012494714 6:99821566-99821588 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1017103215 6:150866117-150866139 CCCGCTCCCCACGGCGGTCCCGG - Intronic
1017164088 6:151391335-151391357 CCGCCCCCCCACCGCCTTCCCGG + Intronic
1018653285 6:166008682-166008704 CCGGCGCCCCGCAGGCTTCCCGG - Intergenic
1018945787 6:168346012-168346034 CCGGCTTCCCCCGGCTGCCCCGG - Intergenic
1019335368 7:480234-480256 CCGGCCTCCCCGGCCCTTCCTGG + Intergenic
1019354765 7:572706-572728 CCTGCTCCCCTCGGCTCTCCAGG - Intronic
1019473047 7:1231417-1231439 CCGGCACCCCCCACCCTCCCCGG + Intergenic
1019523477 7:1470657-1470679 GCTGCTCCACCGGGCCTTCCTGG - Exonic
1019589496 7:1823740-1823762 CCTGCTCCCACTGGCCTTCCTGG + Intronic
1019624720 7:2010207-2010229 CAGGCTCTCCCCAGCCCTCCTGG + Intronic
1019638284 7:2088555-2088577 CCTGATCTCCCCGGCCTCCCAGG - Intronic
1019912205 7:4107310-4107332 CCGGCAGCCTCCTGCCTTCCGGG - Intronic
1020055887 7:5117386-5117408 CCGGCTTCCTCCTGCCCTCCAGG + Intergenic
1020747248 7:12092901-12092923 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1023000460 7:35801931-35801953 CCGCCATCCACCGGCCTTCCGGG - Intronic
1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG + Intronic
1026867199 7:73831153-73831175 CCGGATCCCCTCAGCCTTCCAGG + Exonic
1026881253 7:73908155-73908177 CTGGCTCCCCACTGCCCTCCAGG + Intergenic
1026885492 7:73940595-73940617 CCTGCTCCCTCTGGCCTTCATGG + Intergenic
1027177858 7:75915771-75915793 CCGGCTCCCCCAGGAGATCCGGG - Intronic
1027725881 7:81805711-81805733 ACTGCTCCCCACGGGCTTCCAGG - Intergenic
1028755371 7:94427633-94427655 CCTGGTCCCCCTGGCCCTCCTGG + Exonic
1029123160 7:98281625-98281647 CGGGCTTCCCCCGCCCTCCCGGG - Intronic
1031389479 7:121195994-121196016 CCATCTCCCCCCGGCCTTCTAGG - Intronic
1032274264 7:130440818-130440840 CCGGCCCCTTCCCGCCTTCCGGG + Intronic
1034083186 7:148299432-148299454 CTGGCTCTGCCCAGCCTTCCTGG - Intronic
1034269710 7:149797647-149797669 CCGGGTCCCCAGGGGCTTCCCGG + Intergenic
1034825148 7:154255518-154255540 CCTGCTCCCTCCTGGCTTCCAGG - Intronic
1035122387 7:156579313-156579335 CCGCCTCCTCCAGGTCTTCCTGG - Intergenic
1035356814 7:158280616-158280638 CCGGCTCCCCCAGGCTCTCTCGG - Intronic
1035381721 7:158445062-158445084 CCAGCTCTCCCCAGCCCTCCTGG - Intronic
1035573304 8:688157-688179 CCGGCTCGCCACGGCCTTGAGGG - Intronic
1035911566 8:3572190-3572212 GGGGCTCCCACCGCCCTTCCTGG - Intronic
1036810858 8:11867223-11867245 CCAACTCCCCCCGGCCTCCAGGG + Intronic
1038041433 8:23727094-23727116 GCGGTTCCCCCCGGCCTGCGCGG - Intergenic
1041004140 8:53483155-53483177 CTGGCTCTCCCCTGCCTTCAGGG - Intergenic
1041388712 8:57330338-57330360 CCTGCTCCTCCCCACCTTCCGGG - Intergenic
1041698857 8:60765697-60765719 GGGGCTGCCCCCGGCCCTCCTGG - Intronic
1042136033 8:65633937-65633959 GCCGCTTCCCGCGGCCTTCCCGG + Intronic
1043582655 8:81732359-81732381 CCGGCGCCACCCGGCCCTCTGGG - Intronic
1046184084 8:110690373-110690395 CCGGCTCTCCCCTGCCTTCAGGG + Intergenic
1047906022 8:129474128-129474150 CTGGCTCTCCCCTGCCTTCAGGG - Intergenic
1049237157 8:141518168-141518190 CCGGCCCTCCCCGCCCTGCCGGG + Intronic
1049279736 8:141738171-141738193 CCGTCTCCCCCCGGGGCTCCTGG - Intergenic
1049591591 8:143465291-143465313 CCGTCCACCCCCTGCCTTCCTGG + Intronic
1049654598 8:143792057-143792079 CCCGCGTGCCCCGGCCTTCCTGG + Exonic
1049777501 8:144413472-144413494 CCAGATCCCCCAGCCCTTCCGGG + Intronic
1049792469 8:144478286-144478308 CCTCCTCCTCCCGCCCTTCCCGG - Intronic
1052769699 9:32676270-32676292 CCCCCTCCCCCCAGCCTTCCAGG - Intergenic
1056719600 9:89060484-89060506 CCTTCTACCACCGGCCTTCCTGG - Intronic
1057489117 9:95508270-95508292 CCGCCTCCAGCCGGCCGTCCCGG + Exonic
1057815325 9:98290049-98290071 CCAGCTGACCCCAGCCTTCCTGG - Exonic
1057916517 9:99059900-99059922 CCAGGTCCCCCTGGCCCTCCAGG + Exonic
1058176009 9:101737655-101737677 CCGGCGGCCCCCGGCCATGCAGG + Exonic
1059419631 9:114183046-114183068 CCAGGTCTCCCCGGCCCTCCTGG + Exonic
1060666099 9:125433075-125433097 CCGGATCCCCCCAGACTCCCAGG - Intergenic
1060979898 9:127785933-127785955 CCGGCTCCCCCTGGCCTCTCGGG + Intronic
1061034734 9:128107203-128107225 TCCGCTCCCCCCGACCTCCCAGG - Intronic
1062117921 9:134818997-134819019 CAGGGTCCCCCAGGACTTCCCGG + Exonic
1062162588 9:135088248-135088270 CCTGCTCCCCGCCGCCTCCCTGG - Intronic
1062309463 9:135928324-135928346 CAGGCTCTCCCCGACCTGCCAGG + Intergenic
1062600447 9:137316654-137316676 CCGTCTCCCCCTGGCCTGCCAGG - Intronic
1203471379 Un_GL000220v1:116652-116674 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1203479200 Un_GL000220v1:160624-160646 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1186220392 X:7343753-7343775 CCAGCACCCCCCGCCCCTCCCGG + Intronic
1186230137 X:7444890-7444912 CAGGCTTCTCTCGGCCTTCCTGG - Intergenic
1186973284 X:14873067-14873089 CAGCCTCCGCCCGGCCTCCCAGG - Intronic
1187207606 X:17197851-17197873 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1195334011 X:103831990-103832012 CCCCCACCTCCCGGCCTTCCGGG + Intronic
1195791051 X:108586717-108586739 CAGGGTCCACCTGGCCTTCCTGG + Exonic
1195797608 X:108668414-108668436 CAGGGTCCCCCAGGCCCTCCTGG + Exonic
1195894680 X:109733335-109733357 CCCGCTCCGCCCGCCCCTCCGGG - Exonic
1197772461 X:130098017-130098039 CCGGCTGCCCCCGCCCTGCCTGG + Intronic
1198518388 X:137429515-137429537 CCAGCTTCCCTCGGCCTCCCCGG - Intergenic
1198772458 X:140145364-140145386 CCGGCTCTCCCTTGCCTTCAGGG - Intergenic
1202589291 Y:26465651-26465673 CCTGCTGCCCCCACCCTTCCAGG + Intergenic