ID: 1195224015

View in Genome Browser
Species Human (GRCh38)
Location X:102773610-102773632
Sequence CTGTGGAGATAGAGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195224015_1195224021 28 Left 1195224015 X:102773610-102773632 CCTTCTACTCTCTATCTCCACAG No data
Right 1195224021 X:102773661-102773683 CAAATAAATAAGAACATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195224015 Original CRISPR CTGTGGAGATAGAGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr