ID: 1195228465

View in Genome Browser
Species Human (GRCh38)
Location X:102822239-102822261
Sequence AGTTATCTAGGAAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195228465_1195228469 15 Left 1195228465 X:102822239-102822261 CCTGCCATCTTTCCTAGATAACT No data
Right 1195228469 X:102822277-102822299 AACAGCTCTTGGCCTGCTAATGG No data
1195228465_1195228468 4 Left 1195228465 X:102822239-102822261 CCTGCCATCTTTCCTAGATAACT No data
Right 1195228468 X:102822266-102822288 TTCTTTTGAGAAACAGCTCTTGG No data
1195228465_1195228470 16 Left 1195228465 X:102822239-102822261 CCTGCCATCTTTCCTAGATAACT No data
Right 1195228470 X:102822278-102822300 ACAGCTCTTGGCCTGCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195228465 Original CRISPR AGTTATCTAGGAAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr