ID: 1195230901

View in Genome Browser
Species Human (GRCh38)
Location X:102845813-102845835
Sequence TAAGAAAGCACAGTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195230900_1195230901 -5 Left 1195230900 X:102845795-102845817 CCAGGCACATAGTTACTCTAAGA No data
Right 1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG No data
1195230897_1195230901 13 Left 1195230897 X:102845777-102845799 CCAGTGCCTAGCATGGTGCCAGG No data
Right 1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG No data
1195230896_1195230901 14 Left 1195230896 X:102845776-102845798 CCCAGTGCCTAGCATGGTGCCAG No data
Right 1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG No data
1195230899_1195230901 7 Left 1195230899 X:102845783-102845805 CCTAGCATGGTGCCAGGCACATA No data
Right 1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195230901 Original CRISPR TAAGAAAGCACAGTGATTGC TGG Intergenic
No off target data available for this crispr