ID: 1195242404

View in Genome Browser
Species Human (GRCh38)
Location X:102965535-102965557
Sequence AAAGGGTATTCCCAGTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195242399_1195242404 12 Left 1195242399 X:102965500-102965522 CCACCAGACCGATTTCTGAAAAT No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data
1195242397_1195242404 18 Left 1195242397 X:102965494-102965516 CCAAGCCCACCAGACCGATTTCT No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data
1195242400_1195242404 9 Left 1195242400 X:102965503-102965525 CCAGACCGATTTCTGAAAATCTG No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data
1195242401_1195242404 4 Left 1195242401 X:102965508-102965530 CCGATTTCTGAAAATCTGAGTGA No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data
1195242396_1195242404 19 Left 1195242396 X:102965493-102965515 CCCAAGCCCACCAGACCGATTTC No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data
1195242398_1195242404 13 Left 1195242398 X:102965499-102965521 CCCACCAGACCGATTTCTGAAAA No data
Right 1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195242404 Original CRISPR AAAGGGTATTCCCAGTGTAT AGG Intergenic
No off target data available for this crispr