ID: 1195252081

View in Genome Browser
Species Human (GRCh38)
Location X:103058872-103058894
Sequence CAGTGCTATTAGAGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195252081_1195252084 13 Left 1195252081 X:103058872-103058894 CCATGTTTCCTCTAATAGCACTG No data
Right 1195252084 X:103058908-103058930 CATTGAAGGTATTTACTCAATGG No data
1195252081_1195252085 26 Left 1195252081 X:103058872-103058894 CCATGTTTCCTCTAATAGCACTG No data
Right 1195252085 X:103058921-103058943 TACTCAATGGCAATAGTGAATGG No data
1195252081_1195252083 -1 Left 1195252081 X:103058872-103058894 CCATGTTTCCTCTAATAGCACTG No data
Right 1195252083 X:103058894-103058916 GTAATACAACTTGTCATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195252081 Original CRISPR CAGTGCTATTAGAGGAAACA TGG (reversed) Intergenic
No off target data available for this crispr