ID: 1195252257

View in Genome Browser
Species Human (GRCh38)
Location X:103060657-103060679
Sequence TTATTTTACCTGCACTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195252255_1195252257 13 Left 1195252255 X:103060621-103060643 CCCGTCACTTTTGCTGTATTCTA No data
Right 1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG No data
1195252256_1195252257 12 Left 1195252256 X:103060622-103060644 CCGTCACTTTTGCTGTATTCTAT 0: 12
1: 39
2: 114
3: 291
4: 852
Right 1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195252257 Original CRISPR TTATTTTACCTGCACTCCAT AGG Intergenic
No off target data available for this crispr