ID: 1195254481

View in Genome Browser
Species Human (GRCh38)
Location X:103079295-103079317
Sequence GAGGTGGGTAGGAGGTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 2, 1: 0, 2: 1, 3: 33, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195254481_1195254499 25 Left 1195254481 X:103079295-103079317 CCCCTTAACCTCCTACCCACCTC 0: 2
1: 0
2: 1
3: 33
4: 350
Right 1195254499 X:103079343-103079365 GGAAGCAGGTACTCACCGTCTGG 0: 1
1: 2
2: 1
3: 9
4: 81
1195254481_1195254495 11 Left 1195254481 X:103079295-103079317 CCCCTTAACCTCCTACCCACCTC 0: 2
1: 0
2: 1
3: 33
4: 350
Right 1195254495 X:103079329-103079351 GCCTGCCCAAGGGAGGAAGCAGG 0: 3
1: 1
2: 3
3: 33
4: 340
1195254481_1195254493 1 Left 1195254481 X:103079295-103079317 CCCCTTAACCTCCTACCCACCTC 0: 2
1: 0
2: 1
3: 33
4: 350
Right 1195254493 X:103079319-103079341 GGCTTTCTGGGCCTGCCCAAGGG 0: 1
1: 2
2: 3
3: 25
4: 251
1195254481_1195254492 0 Left 1195254481 X:103079295-103079317 CCCCTTAACCTCCTACCCACCTC 0: 2
1: 0
2: 1
3: 33
4: 350
Right 1195254492 X:103079318-103079340 TGGCTTTCTGGGCCTGCCCAAGG 0: 1
1: 2
2: 4
3: 47
4: 448
1195254481_1195254494 4 Left 1195254481 X:103079295-103079317 CCCCTTAACCTCCTACCCACCTC 0: 2
1: 0
2: 1
3: 33
4: 350
Right 1195254494 X:103079322-103079344 TTTCTGGGCCTGCCCAAGGGAGG 0: 1
1: 2
2: 3
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195254481 Original CRISPR GAGGTGGGTAGGAGGTTAAG GGG (reversed) Intronic
900636118 1:3666601-3666623 GAGGTGGGCAGGAGGTGGTGGGG - Intronic
900707754 1:4090922-4090944 TAGGTGGGTAAGAGGTGGAGGGG + Intergenic
900835099 1:4997090-4997112 GAAGTGGGTAGGTTGTGAAGGGG + Intergenic
901128063 1:6943199-6943221 GAGGAGGGGAGGAGGAGAAGAGG - Intronic
902226019 1:14996861-14996883 GAGGTGGGTGCGAGGTCATGGGG - Intronic
902385335 1:16072868-16072890 GGGGTGGGGAGGAGGATTAGGGG + Intronic
902458273 1:16552294-16552316 GAGGAGGACAGGAGGTTAATAGG - Intergenic
902475805 1:16686518-16686540 GAGGAGGACAGGAGGTTAATAGG - Intergenic
902493888 1:16855622-16855644 GAGGAGGACAGGAGGTTAATAGG + Intronic
902768336 1:18631379-18631401 GAGGTGGGGTGGAGGTTGGGGGG - Exonic
903151459 1:21413054-21413076 GAGGAGGACAGGAGGTTAATAGG - Intergenic
903164630 1:21511543-21511565 GAAGTGGGTAACAGGTTCAGAGG - Intronic
903714947 1:25358437-25358459 GAGGTGGGTGGGAAGGGAAGGGG - Intronic
903997675 1:27317918-27317940 ATGGTGGGGAGGAGATTAAGGGG - Intergenic
904491685 1:30864396-30864418 GGGGTGGGGAGGAGGTGAAGGGG + Intergenic
904880155 1:33690287-33690309 AAGGTGGGTGGGAGGGTAATGGG - Intronic
905361484 1:37423718-37423740 GAGGTTGGTTGGAGGGTGAGAGG - Intergenic
905831622 1:41073678-41073700 AAGATGGGTAGGAGGGTAGGTGG - Intronic
905863452 1:41364814-41364836 GAGCTGGGTAGAGGGTGAAGTGG - Intronic
906936337 1:50217155-50217177 GAGGTAGGTATGAGCTTAATGGG + Intergenic
908019548 1:59886168-59886190 GAGACGGGTGGGAGGTCAAGAGG - Intergenic
908366852 1:63433475-63433497 GTGGGAGGTAGGAAGTTAAGAGG + Intronic
911949065 1:104148851-104148873 GAGGTGGGAAGGGGGTAAAGGGG + Intergenic
912521589 1:110249311-110249333 GAGATGGGCAGGAGGGTAAAGGG - Intronic
912710302 1:111945038-111945060 GAGGAAGGAAGGAGGTCAAGTGG + Intronic
913172748 1:116247370-116247392 GAGGAGGGTTGGAGGATGAGGGG + Intergenic
913612067 1:120518412-120518434 GAGGAGGACAGGAGGTTAATAGG - Intergenic
914579122 1:149003826-149003848 GAGGAGGACAGGAGGTTAATAGG + Intronic
915313878 1:155017502-155017524 GAGATGGGGAGGAGGAGAAGAGG - Exonic
915316012 1:155029676-155029698 GAGGTGGGGAGGCAGGTAAGGGG - Intronic
915577197 1:156787172-156787194 CAGGTGGGTAGGAGGCACAGAGG + Exonic
915832670 1:159145765-159145787 GAGGTGGGTGGGAGGTAATAAGG - Intronic
916235806 1:162586941-162586963 GACCTGAGTAGGAGGTAAAGGGG - Intronic
916747071 1:167692883-167692905 GAGGTGGGAAGGTGGCCAAGGGG + Intronic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
918325983 1:183411137-183411159 GAGGTGAGAATGAGGTAAAGTGG - Intronic
919814780 1:201430435-201430457 GAGGAGGGTAGGAGTATAGGTGG - Intergenic
919860088 1:201734085-201734107 GAGGTGGGGAGAAGGTTTTGAGG + Intronic
922030154 1:221789894-221789916 AATGTGGGGAGGAGGGTAAGGGG + Intergenic
922209981 1:223479189-223479211 GAGGGGGTTAGGAGGTTGGGGGG + Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
924466771 1:244305316-244305338 GAGATGGGACGAAGGTTAAGGGG + Intergenic
1062842816 10:684404-684426 GAGGAGGGTAGGAGGGTCAGTGG - Intronic
1063167144 10:3473752-3473774 GGGGTGAGTAGGAGGTGAGGAGG - Intergenic
1064691641 10:17924475-17924497 GACTTTGGTAGGTGGTTAAGGGG - Intergenic
1066081948 10:31939661-31939683 GAGGTGGGTGGGAGGATAAAAGG + Intergenic
1066648690 10:37635676-37635698 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1067031574 10:42881366-42881388 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1068584408 10:58780613-58780635 GAAGTGGGAAGGAGGTTTAGGGG + Intronic
1069511387 10:69045151-69045173 GAGGAGGGTAAGAGGAGAAGGGG - Intergenic
1069856632 10:71444641-71444663 GAGGTGGGGAGGAGGAAAAGAGG + Intronic
1072640100 10:97205330-97205352 GAGGTGGGTAGGAGCTGTATAGG - Intronic
1076812982 10:132898807-132898829 GAGGAGGGGAGGGGGTTAAGGGG - Intronic
1077249847 11:1556080-1556102 GAGGTGGGTGGGGGGAGAAGGGG + Exonic
1077264645 11:1642648-1642670 GTGGGGGGTAGGGGGTTGAGGGG + Intergenic
1078719631 11:13872503-13872525 GAGGTTGGCAGGAGGTGATGGGG - Intergenic
1080384276 11:31801487-31801509 GAGGGTGGGAGGAGGTAAAGAGG + Intronic
1081269215 11:41063971-41063993 GAGGTGGGTAGTAAGGAAAGGGG + Intronic
1082799740 11:57405879-57405901 GCTGTTGGTAGGAGGTAAAGAGG + Intronic
1083306185 11:61762984-61763006 GAGGTGGGCAGGAGGATTAGGGG + Intronic
1083728709 11:64642055-64642077 GAGGTGGGAGAGAGGTGAAGGGG + Intronic
1083871686 11:65492067-65492089 GGGGCGGGTAGGAGGTAGAGGGG + Intergenic
1084495799 11:69502337-69502359 GAGGTGTGTATGCTGTTAAGTGG + Intergenic
1084739936 11:71133163-71133185 GAGGTGGGTAGGAGGATGAGTGG + Intronic
1087091855 11:94281711-94281733 GAGGAGGGGAGGTGGTAAAGGGG + Intergenic
1088547849 11:110979657-110979679 GAGGTTGGTAAGAGGCAAAGGGG - Intergenic
1088990311 11:114948045-114948067 GTGGTGGGGAGGGGGTGAAGGGG - Intergenic
1089457629 11:118634679-118634701 GAGGAGGGAAAGAGGTGAAGAGG - Intronic
1090323842 11:125867849-125867871 GAGGAAGGTAGGGAGTTAAGTGG + Intergenic
1092217700 12:6694482-6694504 GAGGTGGGTGGGAGGTGAGCTGG - Exonic
1092964617 12:13629618-13629640 GAGGAGGGAAGGAGGGAAAGAGG - Intronic
1093785105 12:23183851-23183873 TAGTTGGGTAAGAGGTTGAGGGG - Intergenic
1095991299 12:48036432-48036454 GAGGTGGGTGGGAGGCGATGTGG + Intergenic
1096262918 12:50104142-50104164 GAGGTGGGTAGGAGGCAGAATGG + Intronic
1096830112 12:54307282-54307304 GAGGTGGGGCGGAGGTTCTGGGG - Intronic
1100454584 12:94740146-94740168 GAGGTGTTTAGGAGGTAATGGGG + Intergenic
1100827830 12:98491334-98491356 AAGGTGGGGAGGAGGTGAGGAGG - Intronic
1101877633 12:108606199-108606221 GTGGTGGTTAAGTGGTTAAGTGG + Intergenic
1102247360 12:111363672-111363694 CAGGAGGGTAGGAGGTTATGAGG - Intronic
1103061749 12:117863888-117863910 GAGGGAAGTAGGAGGGTAAGGGG - Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1103908461 12:124339356-124339378 TAGGTAGGTAGGTGGCTAAGAGG - Intronic
1103908522 12:124339600-124339622 TAGGTGGGTAGGTGGGTCAGTGG - Intronic
1103962849 12:124620244-124620266 GAGGTGGGAAGGAGGCAAAAGGG - Intergenic
1104289459 12:127455203-127455225 GAGATACGTGGGAGGTTAAGGGG - Intergenic
1105423466 13:20273134-20273156 GAGATGGATATGGGGTTAAGGGG - Intergenic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1108705251 13:52979654-52979676 GAGGTGGGAAGAAGGATGAGAGG + Intergenic
1109370835 13:61417096-61417118 GGGGTGGGGAGGAGGTGGAGTGG - Intronic
1109927444 13:69163001-69163023 GAAGTGGGTGGGTGGGTAAGAGG - Intergenic
1110112554 13:71766208-71766230 GAGGTGAGTAGGAAATTTAGGGG - Intronic
1110741600 13:79003966-79003988 GTGGTAGGTGGGACGTTAAGTGG - Intergenic
1110820905 13:79915072-79915094 GATGTGGGTTGCAGGTAAAGAGG - Intergenic
1112429353 13:99336920-99336942 GAGGTGGGAAGGAGGAAGAGAGG - Intronic
1112562253 13:100525449-100525471 GTGGTGGACAGGAGCTTAAGGGG - Intronic
1114473614 14:22980051-22980073 TGGTTGGGTAGGAGGTTCAGAGG - Intronic
1114486557 14:23066062-23066084 GAGGGGGGAAGGAGGTTAGATGG + Intronic
1114553638 14:23548940-23548962 GAGCTTGGTAGGAGGAAAAGAGG - Intronic
1114702423 14:24692753-24692775 GAGGTGGGCAGGAAGTCAAAGGG + Intergenic
1114891410 14:26928653-26928675 GGGGTGGGTGGGAGGGGAAGTGG + Intergenic
1118979592 14:70705751-70705773 GGGGTGGGCAGGAGATGAAGTGG - Intergenic
1119889735 14:78173891-78173913 GAGTGGGGAAAGAGGTTAAGGGG - Intergenic
1120480651 14:85045373-85045395 GAGATGGATAGGAGCTGAAGAGG - Intergenic
1121485714 14:94312832-94312854 GAGCTGGGGAGGAGGGGAAGGGG + Intronic
1121661012 14:95635161-95635183 GAGGTGGGGATGAGGCCAAGTGG - Intergenic
1122856107 14:104561013-104561035 GAGGAGGGTGGGAGGTGAGGGGG - Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125180486 15:36877614-36877636 GAGGTGTGGAGGGGGCTAAGAGG + Intergenic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1125991553 15:44113690-44113712 GAAGTGGGGAGGAGGGGAAGCGG - Intronic
1126563986 15:50075699-50075721 CAGGTGGGTGGGTGGTTGAGAGG - Intronic
1126669804 15:51105603-51105625 CAGGTGAGTAAGAGGTAAAGTGG - Intergenic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1129648015 15:77455978-77456000 AAAGTGGGTGGAAGGTTAAGGGG - Intronic
1130770086 15:86915630-86915652 GCGGTGGGGGGGAGGTGAAGAGG - Intronic
1130879024 15:88039066-88039088 GAGGTGGATGGCAGGTCAAGAGG + Intronic
1132797304 16:1731457-1731479 CATCTGGGTAGGAGGTGAAGAGG - Intronic
1134224440 16:12380494-12380516 GGGGTGGGTAGGTGGATAGGTGG - Intronic
1134321977 16:13172064-13172086 GAGGAGGGAAGGAGGGAAAGGGG - Intronic
1134449358 16:14354110-14354132 GAGGAGGGAAGGAGGAAAAGAGG + Intergenic
1137520347 16:49189864-49189886 GAGATGGGGAAGAGGTGAAGAGG - Intergenic
1141028322 16:80568404-80568426 GAGGTGGGGATGTGGTTGAGTGG - Intergenic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1142639708 17:1279028-1279050 CAGGTGGGGAAGAGGATAAGGGG - Intergenic
1143369558 17:6429988-6430010 CAGGTGGGTAGATGGATAAGAGG + Intronic
1143867705 17:9935915-9935937 CAGGTGGGTAGGAGGTCCAGGGG + Intronic
1143908368 17:10227473-10227495 GAGGTGGGGAGGCCATTAAGAGG + Intergenic
1144955510 17:19017059-19017081 GAGGTGGGAAGGAGGGTCAAGGG - Intronic
1146372713 17:32275421-32275443 GAGGTCGGAAGGAGGAGAAGGGG + Intronic
1148081766 17:44970746-44970768 GGGTCGGGTAGGTGGTTAAGGGG - Intergenic
1148337407 17:46851282-46851304 GAGGCGGGGAGGAGGGTACGAGG - Intronic
1148340886 17:46872771-46872793 GAGGTGGGGAGGAGGGCTAGGGG + Exonic
1148757483 17:49981167-49981189 AAGGTGGGTAGGAGGATTTGAGG - Intergenic
1148964430 17:51422764-51422786 GAGGTGTGGAGGAGGATTAGGGG + Intergenic
1149564443 17:57631098-57631120 GAGGTGGGAAGTGGGTAAAGTGG - Intronic
1151342046 17:73477767-73477789 GAGGTGACTGGGAGGTTGAGGGG - Intronic
1152035482 17:77869693-77869715 GAGGTGGAGGAGAGGTTAAGGGG - Intergenic
1152117205 17:78395726-78395748 CAGATGGGTAGAAGGTAAAGAGG + Intronic
1152266263 17:79296795-79296817 GAAGTGGGGAGGAGGAAAAGAGG - Intronic
1152728117 17:81957662-81957684 CAGGTGGCTAGGAGGGTGAGAGG - Intronic
1152740960 17:82018142-82018164 GAGGTGGGCTGGAGGGGAAGTGG + Intergenic
1152818554 17:82423843-82423865 GAAGTGGGGAGGAGAATAAGGGG + Intronic
1154338161 18:13482241-13482263 GAGGTGGGCAGCGGGTTCAGAGG - Intronic
1155102561 18:22626895-22626917 GAGGTGGGTAGGAGAATGGGAGG - Intergenic
1155400819 18:25437347-25437369 GAGGTATGTAGGAGTTTAAGTGG - Intergenic
1155570139 18:27184562-27184584 GAGGTGGGAGGGAAGTTAGGGGG - Intronic
1156973411 18:43185837-43185859 GTTCTGGGTAGGAGGGTAAGGGG - Intergenic
1157358965 18:46961297-46961319 GGGGTGGGTAGCAGGAGAAGTGG + Intronic
1158876989 18:61743271-61743293 GAGGTGGGAAGCAGGCTCAGGGG - Intergenic
1160744489 19:704217-704239 GAGGCGGGTCCGAGGTTCAGGGG + Intergenic
1161415725 19:4145431-4145453 GAGGTGGGGAGGAGGGGAAGAGG + Intergenic
1161451763 19:4350270-4350292 GAGGTGGGGAGGATGGGAAGGGG + Intronic
1162718427 19:12647941-12647963 GAGGTGAGTTGGTGGTTTAGGGG + Intronic
1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG + Exonic
1163608433 19:18288459-18288481 GGGTGGGGTAGGAGGGTAAGTGG - Intergenic
1163765791 19:19162630-19162652 GAGGTGGGAAGGAGGGTCTGAGG - Intronic
1164521032 19:28980036-28980058 CTGGTGGGTTGGAGGTAAAGTGG - Intergenic
1164946163 19:32294940-32294962 GGGGTGGGCAGGAGGTCAAGAGG + Intergenic
1165420651 19:35720576-35720598 GAGGGGTGGAGGAGGTGAAGGGG - Exonic
1165434332 19:35788122-35788144 GGGGTGGGCAGGAGGGGAAGAGG - Exonic
1166136326 19:40779125-40779147 GAGGGTGGTAGGAGGTGAAGAGG + Intronic
1166344230 19:42155448-42155470 GAGGTGGATAGGAGGGCCAGAGG - Intronic
1166568092 19:43777381-43777403 CAGGTGGGTAGGAAGGGAAGGGG - Intronic
1167324093 19:48813361-48813383 GAGGGGGGAAGGAGGTCAAGAGG + Intronic
1168338142 19:55608153-55608175 AAGATGGGGAGGAGGTGAAGGGG + Intronic
1168524225 19:57075944-57075966 GAGATGGGGAGGAGGCTGAGAGG - Intergenic
1202709817 1_KI270714v1_random:12372-12394 GAGGAGGACAGGAGGTTAATAGG - Intergenic
925906075 2:8540289-8540311 ACGGTGGGTAGGAGGGTATGGGG - Intergenic
926645855 2:15289183-15289205 GAGGTGGGTAGGTGGGTGGGTGG - Intronic
927009226 2:18884812-18884834 GTGGTGGGTAGGGGATAAAGAGG + Intergenic
927023243 2:19039655-19039677 GAGGTGGGTAGAAGCCTAAAAGG - Intergenic
929564708 2:42977074-42977096 GGGGTGGGTGGGAGGTTGTGTGG + Intergenic
930729670 2:54715908-54715930 GAGGTGGGTAGGCGGGGAAATGG - Intergenic
931568376 2:63640957-63640979 AAGGTTAGTAGGAGGTTAGGAGG - Intronic
932598956 2:73111393-73111415 GATCTGGGTAGGAGGGTAAGGGG - Intronic
933617396 2:84496853-84496875 GAGAGGGGTAGGAGATTAACTGG - Intergenic
934865254 2:97803770-97803792 TTTGTGGGTAGGAGGTGAAGAGG + Intronic
935332727 2:101988803-101988825 GAGGGGGGTTGGAGGGAAAGTGG + Intergenic
935661639 2:105471698-105471720 GATGTGGGCATGAGGTCAAGTGG + Intergenic
935960212 2:108418486-108418508 GAGCTGTGTAAGTGGTTAAGTGG + Intergenic
936810048 2:116387596-116387618 GATATGGGTAGAAAGTTAAGAGG - Intergenic
938690658 2:133786081-133786103 GCGGTGGGTAGGGGGGTTAGGGG + Intergenic
939369716 2:141283428-141283450 GAGGTGGGGAGGTGGTGAGGTGG + Intronic
940160586 2:150708346-150708368 GGGGAGGGGAGGAGGGTAAGTGG + Intergenic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942868414 2:180705024-180705046 CCTGTGGGTTGGAGGTTAAGAGG - Intergenic
944256169 2:197625585-197625607 GTGGTGGGGAGGCTGTTAAGAGG - Intronic
944505927 2:200410640-200410662 GAGATGGGTGGGAGGGGAAGGGG - Intronic
946062584 2:216956819-216956841 GAAGTGGGTAGGAGGAAAAGGGG + Intergenic
946315353 2:218907820-218907842 GAAGTGGGTAAGAGATTAGGGGG + Intergenic
946502593 2:220265524-220265546 GAGGGAGGTGGGAGGGTAAGAGG + Intergenic
947510604 2:230750229-230750251 GAGGTGATTAGGTCGTTAAGAGG + Intronic
948125028 2:235558207-235558229 GAGGTGGGTGGGATGCTCAGTGG + Intronic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
948666119 2:239535859-239535881 GAGGGGGTGAGGAGGTAAAGAGG - Intergenic
1168761470 20:352992-353014 GAGCTGGGAAGGAAATTAAGAGG + Intronic
1169860239 20:10143662-10143684 GTTGGGGATAGGAGGTTAAGGGG + Intergenic
1170236569 20:14112221-14112243 GTGGGGGGTTGGAGGGTAAGTGG + Intronic
1170487103 20:16829503-16829525 GTGGTGATTAGGAGGTTAAGAGG - Intergenic
1171316471 20:24200014-24200036 GAGGAGGGTAGGAGGTTCGTGGG + Intergenic
1172947003 20:38697423-38697445 GAAGTGGATGGGAGGTGAAGTGG + Intergenic
1173125896 20:40335697-40335719 GAGGCGGGTGGGAGGTGGAGGGG + Intergenic
1173351096 20:42246301-42246323 GGGGAGGGTAGGAGGAGAAGAGG - Intronic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1176969102 21:15245498-15245520 TAGGAGGGTAGGAGGGTAGGAGG + Intergenic
1177225872 21:18255076-18255098 TAGGTGGTTAGGTGGTTAAATGG + Intronic
1178743297 21:35223547-35223569 GGAGTGGGTAGAAGGATAAGAGG + Intronic
1180053760 21:45346173-45346195 GGGGTGTGTAGCAGGATAAGAGG + Intergenic
1180216321 21:46325315-46325337 GAGGCGGGCAGGAGGGGAAGGGG + Intronic
1182332030 22:29557856-29557878 GTGGTAGGTAGGTGGTTGAGGGG - Intronic
1182422423 22:30254870-30254892 GTGGAGGGGAGGAGGCTAAGTGG + Intergenic
1183040791 22:35176405-35176427 GAGGTGGTGAGGACTTTAAGAGG - Intergenic
1183891042 22:40928985-40929007 GAGGTGGGAAGGTGGGTATGGGG - Exonic
1184389351 22:44194471-44194493 TAGGTGGGTGGGTGGATAAGTGG - Intronic
1184545887 22:45167244-45167266 GAGGTGGGTAGCAGGGGAAATGG + Intronic
1184661548 22:45967703-45967725 GTGGTGGGTGGGAGGGGAAGGGG + Intronic
1203298249 22_KI270736v1_random:59012-59034 GAGGTGGAGAGGAGCTGAAGGGG + Intergenic
949145985 3:700756-700778 GAGGTGGGAAGGGAGTGAAGTGG + Intergenic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
950453140 3:13076837-13076859 TAGGAGGGTGGGAGGTAAAGGGG - Intergenic
950645281 3:14373378-14373400 GAGCTGGGTAGGAGGAGGAGGGG - Intergenic
951582758 3:24183222-24183244 GAGGTGGGCACAAGGCTAAGAGG + Intronic
952944196 3:38466210-38466232 GAGGTAGGTAGGAGGTCAGATGG + Intronic
953695044 3:45151409-45151431 GAGGTATGTAGGAGGTTTGGAGG - Intergenic
954628772 3:52037089-52037111 GAGGTGCTCAGGAGGTTCAGGGG + Intergenic
955376878 3:58404705-58404727 GATTTGGGTAGGAGGATAAAAGG + Intronic
956852891 3:73247148-73247170 AAGGTGTATAGGAGGTTAAAGGG - Intergenic
958490446 3:94766041-94766063 GAGGTGGCAAGGAGGTGAAATGG + Intergenic
959021338 3:101190764-101190786 GAGGTTTGGAGGAGGTAAAGAGG + Intergenic
959433301 3:106282626-106282648 GAGATGGGAAGGAAGTGAAGGGG - Intergenic
960231659 3:115235126-115235148 GAGGTTTGTAGGAGGTAAAATGG + Intergenic
960465849 3:117996503-117996525 GAGGGGGGGAGGAGGAGAAGAGG - Intergenic
962449523 3:135500984-135501006 GAGGCGGGCAGGAGGAGAAGTGG + Intergenic
962571659 3:136719632-136719654 TAGGTGGGTAGGTGGGTAGGTGG + Intronic
962678561 3:137775160-137775182 GATATGGGTGGGAGGTCAAGAGG - Intergenic
962916211 3:139906156-139906178 GAAGTGGATAGGAGGTTGGGCGG - Intergenic
964419099 3:156482484-156482506 GAGGGGGCTAGGAAGTTATGGGG + Intronic
965513628 3:169596998-169597020 GGGGTTGGAAGGAGGTGAAGAGG + Intronic
965795815 3:172437695-172437717 GATGTAGGTAGGAGGTAAAGGGG - Intergenic
969370113 4:6726652-6726674 GAGGTGGGCACGAGGTCAGGAGG - Intergenic
969424353 4:7115580-7115602 GAGGTGAGGAGGAGGTGAGGTGG + Intergenic
969424359 4:7115602-7115624 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424362 4:7115613-7115635 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424364 4:7115624-7115646 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424370 4:7115646-7115668 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424373 4:7115657-7115679 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424375 4:7115668-7115690 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424381 4:7115690-7115712 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424384 4:7115701-7115723 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424386 4:7115712-7115734 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424392 4:7115734-7115756 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
970319279 4:14859922-14859944 GAGGTGGGGAGGAGATGAAGGGG + Intergenic
970506546 4:16736091-16736113 GAGGTGGGAAGGAGTGTAGGAGG - Intronic
971766739 4:30842045-30842067 GAGCTGGGTATGAGGATGAGAGG + Intronic
973807898 4:54543085-54543107 GGGGTGGGTGGGAGGATGAGAGG + Intergenic
977192837 4:94022043-94022065 GAGATGGGTATAGGGTTAAGGGG - Intergenic
977997984 4:103517668-103517690 GAGGAGGGAAGGAGGTTGGGGGG - Intergenic
978963286 4:114710200-114710222 GAGGTCAGTAGGAGCTCAAGAGG - Intergenic
985689292 5:1298330-1298352 GAGGCGGGCAGGAGGGTCAGAGG - Intergenic
987212257 5:15694765-15694787 GAGCTGGGGAGGAGGTTGAGTGG + Intronic
987502603 5:18732874-18732896 GAGCAGGGTAGGAGTATAAGGGG - Intergenic
988494228 5:31731213-31731235 GCTGTGGTTAAGAGGTTAAGAGG + Intronic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
992837724 5:80656687-80656709 GATGTGTATAGGAGGTTAAGGGG + Intronic
995284938 5:110377480-110377502 GAATTGGGGAGGAGGTAAAGAGG - Intronic
996229996 5:121051428-121051450 GAGGTGGGAAGGAGGGTCAAGGG - Intergenic
997820193 5:137058683-137058705 AAGGTAGGTAGGAAGTTCAGGGG + Intronic
997895568 5:137713118-137713140 GAGATGGTTAAGAGGTTGAGGGG + Intronic
998399231 5:141839503-141839525 GAGGTGGGGAGGAGCTGGAGAGG + Intergenic
999739850 5:154541894-154541916 GAGGTGGGTAGGAACCTGAGGGG + Intergenic
999861570 5:155653240-155653262 GAGCAGGGTAGGAGGGAAAGGGG - Intergenic
1000092762 5:157944509-157944531 GGGGTCGGTAGGAGGCTAACTGG + Intergenic
1001690807 5:173631311-173631333 GAGGGGGGTAGGAGATGAGGAGG - Intergenic
1001690840 5:173631411-173631433 GAGGGGGGTAGGAGATGAGGAGG - Intergenic
1001690863 5:173631479-173631501 GAGGGGGGTAGGAGATGAGGAGG - Intergenic
1001690878 5:173631522-173631544 GAGGGGGGTAGGAGATGAGGAGG - Intergenic
1001740433 5:174048706-174048728 GAGGTGGGTGGGAGAGTAAGGGG - Intronic
1001816914 5:174677137-174677159 GGGGTGGGTAGGAAGTAAGGTGG - Intergenic
1002060252 5:176621459-176621481 GAAGTGGGATGGAGGTGAAGGGG + Intronic
1002470214 5:179430500-179430522 GAGATGGGCAGGAGGGTAGGTGG + Intergenic
1003539160 6:7003019-7003041 GAGGTGGGTCAGAGGTTTTGAGG - Intergenic
1004334778 6:14754821-14754843 GAGGTGGCAGGGAGGTGAAGAGG + Intergenic
1004367991 6:15028088-15028110 GGGGAGGGTAGGAGGTGAGGTGG + Intergenic
1005559284 6:27021092-27021114 GAGGTGGGTAGGAAGTAGATAGG + Intergenic
1006375556 6:33669960-33669982 GAGGTGGGGAGGTGGTGAAAGGG - Intronic
1006824655 6:36925888-36925910 GAGGTGGGGAGTTGGTTAGGTGG - Intronic
1007194798 6:40051092-40051114 GTGGGGGCTAGGGGGTTAAGAGG + Intergenic
1007280018 6:40705068-40705090 TGGGTGGGTAGGAGGTTACCAGG - Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1007505626 6:42333038-42333060 GTGATGGGTTGGAGGTTAATAGG + Intronic
1007628215 6:43258466-43258488 GAGGTGGGCAGGGGCTTCAGGGG + Intronic
1007912222 6:45527402-45527424 GGGGTAGGGAGGAGGTTAGGAGG + Intronic
1011410290 6:87059855-87059877 GAGGAGGGGAGGAGGGTAGGTGG + Intergenic
1011417429 6:87137295-87137317 GAGGAGGGGAGGAGGGGAAGGGG - Intergenic
1011483302 6:87816568-87816590 GTTGTGGATAGGAGGTGAAGTGG + Intergenic
1011499947 6:87976972-87976994 GAGGTGAGGAGGAGGTGAGGTGG - Intergenic
1011617643 6:89211768-89211790 GAGGTGTTGAGGATGTTAAGAGG - Intronic
1014159418 6:118151142-118151164 GAAGTGGTTAGAAGGCTAAGAGG - Intronic
1015082741 6:129247921-129247943 GAGGTGGGAAGGGGGAAAAGAGG - Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017822842 6:158061406-158061428 GAGATGGGAAGCAGGTCAAGGGG - Intronic
1019173219 6:170146446-170146468 GAGGTGTGTAGGAGGGTGAGAGG + Intergenic
1019223556 6:170493388-170493410 GAGGAGGGGAGGAGGGGAAGAGG + Intergenic
1019223571 6:170493434-170493456 GAGGAGGGCAGGAGGGGAAGAGG + Intergenic
1019704850 7:2492699-2492721 TAGGTGGGTGGGTGGGTAAGTGG - Intergenic
1019824004 7:3268564-3268586 GTGGGGGGTAGGGCGTTAAGAGG - Intergenic
1021023397 7:15633283-15633305 GAGCTGAGTAGGAGGTGAATGGG - Intronic
1022001487 7:26230354-26230376 GAGGTGGGTAGGAGGTTGGAAGG - Intergenic
1024509718 7:50194124-50194146 GAGATGGGAAAGAGGTTAGGGGG + Intergenic
1025117193 7:56268428-56268450 GAGGTGGGAAGGAGGAAAGGAGG - Intergenic
1026275136 7:68870003-68870025 GAGGTGGGTAAGGGGTAAGGAGG + Intergenic
1028500935 7:91518320-91518342 TAGGAAAGTAGGAGGTTAAGAGG + Intergenic
1028631254 7:92936339-92936361 GTGATGGGTAGGTGGTTGAGTGG - Intergenic
1029451435 7:100643441-100643463 GAGGTGGGGAGGGGCTTCAGAGG - Intronic
1030065520 7:105656075-105656097 GAGGTGGGCAGGAGGCAGAGAGG - Intronic
1030067850 7:105674141-105674163 GCAGTGGGTAGGAGGTGAAGAGG - Intronic
1030645974 7:112062214-112062236 GAGGTTGGTGGGAGGAAAAGTGG - Intronic
1031610343 7:123819086-123819108 GAGGTGGTTAGGAGGGAGAGGGG - Intergenic
1031843797 7:126780260-126780282 AAGGTGCATAGGAGGTTAAAGGG - Intronic
1033542716 7:142372172-142372194 TAGGTGGGGAGGAGGCTGAGAGG + Intergenic
1034460986 7:151197983-151198005 GAGGTGGGTAGAAGGGTTGGTGG + Intronic
1034460995 7:151198035-151198057 GAGGTAGGTAGAAGGGTGAGTGG + Intronic
1034461008 7:151198091-151198113 GAGGTGGGTAGAAGGGTGGGTGG + Intronic
1034461035 7:151198195-151198217 GAGGTGGGTAGGTGGGTGGGTGG + Intronic
1034461046 7:151198243-151198265 GAGGTGGGTAGAAGGGTGGGTGG + Intronic
1034611093 7:152369570-152369592 GAGGTGATTAGGTTGTTAAGAGG + Intronic
1034989448 7:155538790-155538812 GGGGTGGGCAGGAGGTGAATAGG - Intergenic
1035045265 7:155961638-155961660 GAGGTGGGTGGGAGCTGAGGGGG + Intergenic
1035276772 7:157752627-157752649 GAGGTGGGCTGTAGGTTAGGTGG - Intronic
1036104584 8:5826089-5826111 GAGGAAGGTAGGAAGTTAAGTGG + Intergenic
1037121617 8:15294463-15294485 GAGGTGAGTAAGGGTTTAAGCGG - Intergenic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1037701028 8:21273925-21273947 AGGGAGAGTAGGAGGTTAAGAGG + Intergenic
1038093005 8:24275324-24275346 TAGGTGGGTAGGGGGTTGGGGGG + Intergenic
1038397390 8:27257303-27257325 GGGATGGGTGGGAGGTTGAGAGG - Intronic
1039195417 8:35025724-35025746 GAGGTGGGGAGGTGGATGAGTGG + Intergenic
1040305407 8:46209318-46209340 GAGGCAGGTAGGGGGGTAAGAGG + Intergenic
1040644675 8:49384289-49384311 GTGGAGGGTAAGAGGTTATGCGG - Intergenic
1041922403 8:63196780-63196802 GAGGTGGGTTGGAGGGTCGGGGG + Intronic
1042101547 8:65280308-65280330 AAGGTGGGTAGGAGAGTGAGAGG + Intergenic
1044765229 8:95565112-95565134 GAGGTTGGCAGGAGGTTGTGGGG + Intergenic
1044935006 8:97285573-97285595 GAGGTGGGGAGGACTTGAAGTGG - Intergenic
1045974348 8:108114544-108114566 GAGGGGATTAGGAGGTTTAGGGG - Intergenic
1046634102 8:116653033-116653055 GCTGTGGCTGGGAGGTTAAGGGG + Intronic
1049030095 8:140028828-140028850 CAGGTGGGTAGGAGTTGCAGAGG + Intronic
1049283699 8:141763274-141763296 GGGGAGGTCAGGAGGTTAAGAGG + Intergenic
1049468725 8:142765471-142765493 GGGGTGGGGAGGAGGTGGAGGGG + Intronic
1049760841 8:144331422-144331444 GAGGTGGGGAGGAGTGTAGGGGG + Exonic
1050327199 9:4509087-4509109 GGGGTGGGTAGGAGTTTATTAGG + Intronic
1052447216 9:28578276-28578298 GAGGTGGGGAGGTGGGTAATGGG + Intronic
1053123414 9:35561921-35561943 GAGGTGGGTGGGAGGGTGGGAGG - Intronic
1053435943 9:38074542-38074564 CAGGAGGTTAGGAGTTTAAGGGG - Intergenic
1054459269 9:65453990-65454012 CAGATGGGTAAGAGGGTAAGTGG + Intergenic
1054754304 9:68941904-68941926 TAGGTAGGCAGGAGGTTAGGCGG + Intronic
1055485888 9:76756056-76756078 GTGGTTGGTAGGAGGTGAAAGGG - Intronic
1055497104 9:76866824-76866846 GAAGTAGGGAGGAAGTTAAGAGG + Intronic
1056025950 9:82495709-82495731 GAGGTGGCAAGGGGGTTAAATGG + Intergenic
1056259938 9:84838249-84838271 GAGATGGGGAGGAAGTTATGTGG + Intronic
1056802352 9:89701478-89701500 GCGGTGGGTGGGAGGTGGAGGGG - Intergenic
1057164465 9:92914936-92914958 GAGGTGGGTAGGAAGGTGAATGG - Intergenic
1057611725 9:96550208-96550230 GAGGTGGGTAGGAAGGGAAGAGG - Intronic
1059265999 9:113031237-113031259 GAGGTGATTAGGTTGTTAAGAGG - Intergenic
1059357243 9:113709500-113709522 GAGGTGGGTAGAATGTTCACAGG + Intergenic
1059760235 9:117330588-117330610 TAGGTGGGGAGGAGGCGAAGAGG - Intronic
1060298444 9:122359357-122359379 GAGGTGGGGAGGAGGAGAAATGG - Intergenic
1061057779 9:128233457-128233479 GAGCTGGGGAGGGGGTTCAGGGG - Intronic
1061931089 9:133833607-133833629 GAGGGAGGTAGGAGGGTAGGAGG - Intronic
1062245351 9:135563227-135563249 CAGGTGGGTAGGTGGGTAGGTGG + Intronic
1062267192 9:135692582-135692604 GCCGTGGGCAGGAGGTTAGGAGG - Intergenic
1186383829 X:9089359-9089381 GGGGTGGGTAGGGGGTTGGGAGG - Intronic
1187227588 X:17388600-17388622 GAGGAGAGTAGGAGGATAAGAGG + Intronic
1188634460 X:32411596-32411618 GAGGTAGGTAGGAAGAAAAGGGG - Intronic
1188988842 X:36792375-36792397 GAGATGGGTAGAAGTTCAAGTGG - Intergenic
1189803159 X:44710127-44710149 AAGGTGGGGAGGTGTTTAAGGGG - Intergenic
1190138862 X:47823180-47823202 GAGGAGGGCAGGAGGGTAAGAGG + Intergenic
1190492249 X:50993783-50993805 GAGGTGAGGAGGTGGGTAAGGGG + Intergenic
1192209803 X:69120575-69120597 GAGGTGGGTTGGAGGTGGAAGGG - Intergenic
1192736038 X:73850681-73850703 GAGGGGGGTAGGGGGGTAGGGGG + Intergenic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1195480526 X:105339489-105339511 CATATGGGTAGGAGGATAAGGGG + Intronic
1195774087 X:108384067-108384089 TAGGTGGGTAGGTGGGTAACTGG - Intronic
1197532150 X:127642667-127642689 GAGGTGGGAGGGAGGGCAAGGGG - Intergenic
1201144725 Y:11058009-11058031 GAGGTGTGTAGGAAGATGAGTGG + Intergenic
1201575906 Y:15461116-15461138 GAGTTGAGGAGGAGGTTAGGAGG - Intergenic