ID: 1195254760

View in Genome Browser
Species Human (GRCh38)
Location X:103080866-103080888
Sequence CCAGTGAGGTAGCAGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 4, 2: 0, 3: 47, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195254760_1195254763 2 Left 1195254760 X:103080866-103080888 CCAGGGCTCTGCTACCTCACTGG 0: 1
1: 4
2: 0
3: 47
4: 295
Right 1195254763 X:103080891-103080913 GTCCGTCAGTCTGCCTGTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 130
1195254760_1195254765 8 Left 1195254760 X:103080866-103080888 CCAGGGCTCTGCTACCTCACTGG 0: 1
1: 4
2: 0
3: 47
4: 295
Right 1195254765 X:103080897-103080919 CAGTCTGCCTGTCCTGGCCCTGG 0: 1
1: 0
2: 1
3: 41
4: 412
1195254760_1195254767 19 Left 1195254760 X:103080866-103080888 CCAGGGCTCTGCTACCTCACTGG 0: 1
1: 4
2: 0
3: 47
4: 295
Right 1195254767 X:103080908-103080930 TCCTGGCCCTGGCCAAGACCAGG 0: 1
1: 0
2: 9
3: 59
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195254760 Original CRISPR CCAGTGAGGTAGCAGAGCCC TGG (reversed) Intronic
900342455 1:2195326-2195348 ACTTTGAGGTCGCAGAGCCCGGG - Intronic
900461258 1:2803046-2803068 CCAGGGCTGTAGAAGAGCCCGGG + Intergenic
901452797 1:9346064-9346086 CCAGTGAGCGGGCAGAGCCCAGG + Intronic
903402636 1:23067390-23067412 TCAGTGAAGGAGCAGAGGCCAGG + Intronic
903809221 1:26025441-26025463 CCAGAGAGGTGGAATAGCCCAGG + Intronic
904129828 1:28267439-28267461 CCACTGAGGAGGCAGAGCTCTGG - Intronic
904314624 1:29652198-29652220 CCAGGGAGGCAGCAGATCCTTGG + Intergenic
904365211 1:30006502-30006524 CTGGTGAGGTGTCAGAGCCCTGG + Intergenic
904479650 1:30785893-30785915 CTAGTTAGGGAGCAGAGCCCAGG - Intergenic
906153145 1:43599461-43599483 CCAGTGGGGTAAGACAGCCCTGG - Intronic
906519378 1:46458273-46458295 CCTGTGAGGGAGCAGAGCTGGGG - Intergenic
906676026 1:47694282-47694304 TCCCTGAGGTAGCAGAGGCCTGG + Intergenic
906945445 1:50290660-50290682 CCAGTGAAGGAGGAGTGCCCAGG + Intergenic
906961004 1:50419441-50419463 CCAGAGGGCTAGCGGAGCCCGGG + Exonic
907200574 1:52723288-52723310 CCAGTGAGATAGAAGACCCGAGG + Intergenic
907871442 1:58447107-58447129 CCAGGGAGGTTGCTGAGCCATGG - Intronic
908043494 1:60142487-60142509 CTAGTGAAGGAGCAGAGCCAGGG - Intergenic
908065201 1:60395925-60395947 CCAGTGAGGTATGAAAGCTCAGG + Intergenic
908578677 1:65490013-65490035 CCTGAAAGGTAGCAGAGCCAGGG - Intronic
908895375 1:68892720-68892742 CCAGTAAGTTAGCATAGCCCTGG - Intergenic
910144612 1:84065034-84065056 CCAGTCAGGCACCAGAGCCCTGG - Intergenic
912757440 1:112336321-112336343 CAGGTGAGGCACCAGAGCCCAGG + Intergenic
912957695 1:114167040-114167062 CAAGAGAGGTAGCAATGCCCTGG - Intergenic
915314985 1:155023439-155023461 CAAGTGAGGCAGTAGAGACCTGG + Exonic
917523304 1:175765764-175765786 CCAGTGCATAAGCAGAGCCCAGG + Intergenic
921618617 1:217301428-217301450 TGAGTGAGGTAACACAGCCCAGG - Intergenic
921939986 1:220829390-220829412 CCAGGGAATCAGCAGAGCCCTGG + Intergenic
922386862 1:225095025-225095047 CCAGTGAGGTTGCAGAGAAAAGG + Intronic
922722216 1:227904920-227904942 CCTAGGAGGGAGCAGAGCCCAGG - Intergenic
923888323 1:238182166-238182188 CAGGTGAGGTGTCAGAGCCCAGG - Intergenic
924238596 1:242020526-242020548 AGAGTGAGGCAGGAGAGCCCAGG - Intergenic
1063175131 10:3544133-3544155 GCAGTGGGGTTGCAGCGCCCAGG - Intergenic
1063215052 10:3916955-3916977 CCAGTGAGGAAGCAGAGGCTTGG + Intergenic
1063310864 10:4950590-4950612 ACAGAGAGGAACCAGAGCCCTGG + Intronic
1067781129 10:49208339-49208361 TAAGGGAGGAAGCAGAGCCCAGG + Intergenic
1068926987 10:62550821-62550843 GCAGTCTGGTTGCAGAGCCCAGG - Intronic
1070731448 10:78831375-78831397 CCAGATAGGTAGCAGAGCAAAGG - Intergenic
1071419685 10:85479698-85479720 CCAGTGAGCTATCAGAGGCTTGG + Intergenic
1072703703 10:97664431-97664453 CCAGTGAGAAAACAGAGCCTCGG - Intronic
1073429884 10:103479168-103479190 CCAAGGAGGAAGCAGTGCCCAGG + Exonic
1074080695 10:110166025-110166047 CGAATGAGGGAGCAGAGCTCAGG - Intergenic
1074260910 10:111852236-111852258 CCAGTGGAGCAGGAGAGCCCTGG - Intergenic
1074290829 10:112137037-112137059 GCAGTGTGGGAGTAGAGCCCCGG - Intergenic
1074401113 10:113141737-113141759 CCAGTGAGGGAGCCGAGGCTTGG - Intronic
1074852924 10:117453429-117453451 CCAGTCTGGGAGCAGAGCCTGGG - Intergenic
1075317241 10:121462661-121462683 CCGGTGAGGAAGCTGAGCCCAGG + Intergenic
1075398083 10:122142238-122142260 CAAGTGTGGGAGCAGAGCCAGGG - Intronic
1075486293 10:122824069-122824091 GAAGTGAGGCAGCAGAGCCCAGG - Intergenic
1075630161 10:123995764-123995786 CCTGTGAGGTGGAAGGGCCCAGG + Intergenic
1075683910 10:124350844-124350866 CATGGGAGGGAGCAGAGCCCTGG - Intergenic
1075949175 10:126462493-126462515 GCAGTGACGTAGCAGAGGCAGGG - Intronic
1076170196 10:128312714-128312736 CCACTGAGGGGTCAGAGCCCTGG - Intergenic
1076407368 10:130221695-130221717 CCAGCGAGGGAACAGAGCCCCGG - Intergenic
1076672336 10:132130185-132130207 CCTGTGAGAAAGCAGAGACCTGG - Intronic
1076857421 10:133124204-133124226 CCGGGGAGGTTGCAGAGCCGGGG - Intronic
1076857438 10:133124256-133124278 CCAGGGAGGGTGCAGAGCCGGGG - Intronic
1076872196 10:133199655-133199677 CGGGTCAGGCAGCAGAGCCCAGG - Intronic
1077360074 11:2137001-2137023 CAGGTGAGGGAGCAGAGACCAGG + Intronic
1077464197 11:2725827-2725849 CCAGGGAGCTCTCAGAGCCCAGG - Intronic
1077485213 11:2835297-2835319 CCAGGGAGGTGGCAGAGACTTGG - Intronic
1077557612 11:3233361-3233383 CCAGAGCGGTGGCAGAGCCCAGG - Intergenic
1078425091 11:11243435-11243457 CCAGGGAAGGAGCACAGCCCGGG + Intergenic
1078859138 11:15231116-15231138 CCAGAGAGGCAAGAGAGCCCAGG - Intronic
1084387405 11:68852721-68852743 CCAGTGAGGTTTGTGAGCCCAGG - Intergenic
1086001068 11:81986821-81986843 CCCGTGAGGCAGCTGAGGCCCGG + Intergenic
1088817848 11:113433585-113433607 GCAGCGAGGCAGCAGAGCTCAGG + Intronic
1089498617 11:118920119-118920141 TCAGTGAGGAAGCAGAGTGCTGG - Intronic
1090399753 11:126441469-126441491 CCAGGAAGCCAGCAGAGCCCAGG - Intronic
1090403090 11:126461321-126461343 CCAGTGAGGGGGAAGAGCCGAGG + Intronic
1091122100 11:133065196-133065218 CCAGTGAAGCAGCCCAGCCCAGG - Intronic
1095512872 12:42973046-42973068 CCTGTGAGGTGGAAGAACCCGGG + Intergenic
1095975692 12:47939536-47939558 CCAGGGAGTGTGCAGAGCCCTGG - Intronic
1096323559 12:50637400-50637422 CCAGTGAGGGAGAAAAGCCTTGG - Intronic
1098406963 12:70137160-70137182 CCAGTGAGGTGTCAGAGCACTGG + Intergenic
1104205531 12:126634899-126634921 CCAGTAAGGCAGCAAAGGCCAGG + Intergenic
1104625928 12:130354642-130354664 CCTGTAAGATAGCAGAGCTCAGG - Exonic
1104657163 12:130581919-130581941 CCAGGGAGGGAGGAGAGGCCAGG - Intronic
1105896393 13:24720199-24720221 CCAGTGAGGGTGCAGAACCTGGG - Intergenic
1107568191 13:41628218-41628240 CCAGAGAGGTAGCAGAGAAAAGG + Intronic
1107865131 13:44695960-44695982 CCAGTGCTGGAGCAGAGTCCTGG + Intergenic
1114084421 14:19229138-19229160 TCAGTGAGGCAGAGGAGCCCAGG + Intergenic
1115773211 14:36687766-36687788 CCAGAGAGGTGGCAGTGGCCAGG - Intronic
1116648446 14:47560033-47560055 CCAGTGAGGTTGCAGAGAAAAGG - Intronic
1117759015 14:59006551-59006573 CAAGGGAGGTGGCAGAGTCCAGG - Intergenic
1119630449 14:76227402-76227424 CCAGTGGAGTACCAGAGTCCAGG + Intronic
1119693825 14:76697061-76697083 CTTGGGAGGTAGCAAAGCCCTGG + Intergenic
1120865225 14:89290774-89290796 TCAGTGATGTGCCAGAGCCCTGG + Intronic
1120972159 14:90216572-90216594 CCAGTGAGGTGGTAAAGACCTGG + Intergenic
1122384015 14:101331701-101331723 CCAGTGAGTTAGGAGAAGCCGGG - Intergenic
1122797110 14:104211512-104211534 CCAGGGAGGAGGCAGAGCCCAGG + Intergenic
1122882730 14:104697270-104697292 CAAGTGAGGGAGCCGAGGCCTGG + Intronic
1123043350 14:105499525-105499547 CCCGGGAAGGAGCAGAGCCCCGG - Intronic
1123060455 14:105592040-105592062 CCGGTGGGGTCACAGAGCCCTGG - Intergenic
1123084933 14:105713011-105713033 CCGGTGGGGTCACAGAGCCCTGG - Intergenic
1202896026 14_GL000194v1_random:10982-11004 CCAGTGAGGCAGAGGAGCCCAGG + Intergenic
1123711626 15:22992127-22992149 CCAGGGAGGAAGTTGAGCCCTGG - Intronic
1125578696 15:40771173-40771195 CCAGAGAGCAGGCAGAGCCCTGG - Exonic
1128363688 15:66981896-66981918 CCCGTGAGTGAGCAGAGCCAGGG - Intergenic
1129372905 15:75109261-75109283 CCAGTGAGGCAGCTGAGGCCAGG + Intronic
1131878747 15:96839421-96839443 CCTGTGAAGGAGCAGAGCTCAGG + Intergenic
1132309420 15:100846199-100846221 GCAGAAAGGGAGCAGAGCCCAGG - Intergenic
1132533697 16:466897-466919 GCAGTGAGATAGGAGAGCCCTGG - Intronic
1133266689 16:4589018-4589040 CCAGTGATGTGTCAGACCCCGGG - Intronic
1133369695 16:5238601-5238623 CCAGGAAGGCAGGAGAGCCCAGG - Intergenic
1134052850 16:11149097-11149119 CCAGTATGTTAGCAGAGGCCAGG + Intronic
1134068828 16:11248128-11248150 GCAGGTAGGTAGCAGAGCCTTGG - Intergenic
1134865311 16:17601758-17601780 CCAGTGAGATAGAAGGCCCCAGG + Intergenic
1135257820 16:20955350-20955372 CCAGTGAGGAAGCGGAGGCATGG + Intronic
1135819085 16:25664593-25664615 CCACTGAGCTAGAAGAGCCAGGG + Intergenic
1135937452 16:26793260-26793282 ACAGTGAGAGAGCTGAGCCCAGG + Intergenic
1136854495 16:33643369-33643391 CCTGTGGGGGAGCAGAGCCAGGG - Intergenic
1137560986 16:49502355-49502377 CCCATGAGGCAGCAGAACCCAGG - Intronic
1137711142 16:50567703-50567725 CCAGGCAGGTAGCGGAGCCATGG - Intronic
1138531980 16:57639490-57639512 CCAGTGAGGGAGCAGTGGCTGGG + Intronic
1138651880 16:58465296-58465318 CCGATGAGGGAGCAGAGCCCCGG + Intronic
1139779753 16:69340535-69340557 CCAGCGAAGTAGAAGAGCCTAGG + Intronic
1141567919 16:84915805-84915827 CCAGTGAGGCAGCAATGCCCTGG + Intronic
1141946096 16:87311036-87311058 CCTTTGTGGGAGCAGAGCCCAGG + Intronic
1142263889 16:89054758-89054780 CCAGGGAGGCAGCAGGGGCCGGG - Intergenic
1203137455 16_KI270728v1_random:1737735-1737757 CCAGTGAGGAAGGAGAGGACAGG - Intergenic
1142645634 17:1312419-1312441 CCAGTGAGGAGGCAAAGCCCAGG - Intergenic
1143558084 17:7674982-7675004 TCAGTGAGGAATCAGAGGCCTGG + Intronic
1144672616 17:17141510-17141532 GCAGGGAGGAAGCAGAGCCCGGG + Intronic
1145035636 17:19538679-19538701 CATGTGAGGAAGCACAGCCCAGG - Intronic
1145234348 17:21198229-21198251 TCTGTGAGGCAGCAGAGCCTGGG - Exonic
1147245121 17:39115287-39115309 CCAATGAGTCAGCAGATCCCAGG + Intronic
1149214012 17:54333266-54333288 CAGGTGAGGTATCAGAGCCCTGG + Intergenic
1150533127 17:66006767-66006789 CAACTGAGGATGCAGAGCCCAGG + Intronic
1150543359 17:66127378-66127400 CCAGTGTGGGAGAAGAGCACAGG - Intronic
1152161530 17:78671358-78671380 TCAGAGAGGTAGGAGAGCCCAGG + Intergenic
1152241029 17:79161263-79161285 CGAGTCAAGTCGCAGAGCCCAGG + Intronic
1152744581 17:82032882-82032904 CAAGGGAGGGAGCAGGGCCCTGG + Intronic
1155559759 18:27062962-27062984 CAGGTGAGGTGTCAGAGCCCTGG - Intronic
1156203989 18:34865974-34865996 TCACTGAGGTGGCAGAGGCCTGG + Intronic
1157088349 18:44605290-44605312 CCAGTGTGGTAGCTGAGGCTGGG - Intergenic
1157400403 18:47382299-47382321 ACAGGCAGGAAGCAGAGCCCCGG - Intergenic
1157558309 18:48627966-48627988 CAAGAGAGGAAGCAGAGACCAGG + Intronic
1157713346 18:49865220-49865242 TGAGTGAGGAAGCTGAGCCCAGG + Intronic
1158125251 18:54093727-54093749 CCAGTGAGGGAGGTGAGACCTGG - Intergenic
1158719975 18:59916199-59916221 CCTGTGAGCTAGCAAAGGCCAGG - Intergenic
1160068886 18:75607167-75607189 TCAGTGAAGAGGCAGAGCCCTGG + Intergenic
1160086379 18:75780844-75780866 CCAGTGAGCAGGTAGAGCCCAGG + Intergenic
1161048582 19:2150531-2150553 CCAGTGAGGTAGCAGCTTGCGGG - Intronic
1161244132 19:3239782-3239804 CCAGTGAGGGGGCAGAGTCAAGG - Intronic
1161353056 19:3804361-3804383 CCCTTGTGGTAGCAGGGCCCGGG - Exonic
1161389554 19:4014064-4014086 CCAGCGAGGAACCAGAGCCCGGG - Intronic
1161585470 19:5103122-5103144 CCGGTGAGTGTGCAGAGCCCAGG + Intronic
1161901528 19:7123041-7123063 CCAGGGAGGGAGGAGAACCCTGG - Intronic
1162022369 19:7873755-7873777 GCAGTGAGGTAGCAGGGTCCAGG - Intronic
1162927825 19:13938864-13938886 CCTGAGAGGTGGCACAGCCCAGG - Intronic
1163819261 19:19486917-19486939 CCAGTGAGCTAGAAGACACCTGG - Intronic
1163923471 19:20315742-20315764 CCAGCGAAGTAGCTCAGCCCAGG + Intergenic
1164439126 19:28258647-28258669 GGAGTGAGGGAGCAGAGCCTGGG - Intergenic
1166948402 19:46411360-46411382 ACAGTGAGGTTCCAGACCCCTGG - Exonic
1166956771 19:46470265-46470287 CCAGGCAGGAAGCAGTGCCCTGG - Exonic
925220420 2:2135054-2135076 CCAGTGAGGGAGCAGGGAGCTGG - Intronic
925526815 2:4812567-4812589 CCTGTGAAGTGGCAGAGCCAGGG + Intergenic
925905525 2:8537662-8537684 ACAGTGATGTGGCAGGGCCCAGG - Intergenic
926177056 2:10603139-10603161 CCAATGAGGTGGGTGAGCCCTGG + Exonic
926590282 2:14733414-14733436 TCAGTGAGGTAGAGGAGTCCAGG - Intergenic
927711549 2:25329174-25329196 CGAGGGAGGGAGAAGAGCCCAGG + Intronic
928456438 2:31426928-31426950 CCAGTGAAGCAGCAGTTCCCAGG + Intergenic
930573261 2:53113173-53113195 CGGGTGAGGTATCAGGGCCCCGG + Intergenic
932075508 2:68659220-68659242 ACACTGTGGTAGAAGAGCCCTGG - Intergenic
932220124 2:69992896-69992918 CTGGTGAGGTGACAGAGCCCTGG + Intergenic
934045237 2:88168313-88168335 CCAATGCTGAAGCAGAGCCCTGG - Intergenic
935319906 2:101876294-101876316 CCACTGAGGAAGCAGAGGGCAGG + Intronic
936018898 2:108979970-108979992 CAAGTGAAGAAGCAGAGGCCAGG - Intronic
936236660 2:110748065-110748087 CCTGTGAGGCGGCAGAGCCCTGG + Intronic
937261297 2:120588094-120588116 CCAGTGAAATAACAGAGGCCTGG - Intergenic
937332286 2:121039028-121039050 CCAGGGAGCCAGCAGAGGCCAGG - Intergenic
938083902 2:128385670-128385692 CCAGGTACATAGCAGAGCCCAGG + Intergenic
938164191 2:129011761-129011783 CCAGTGAGAGAGCAGTGCCCAGG + Intergenic
940415508 2:153414902-153414924 CCAGTCAGGGAGCAGAACTCTGG + Intergenic
940527081 2:154829726-154829748 CTAGTGAGGTTGCAGAGCAAAGG - Intronic
941735169 2:168966120-168966142 CCAGTTAGGTAACAGAGGTCAGG + Intronic
941993089 2:171576034-171576056 CCGGTGAGGTGTCAGAACCCTGG + Intergenic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
946300974 2:218823896-218823918 TCAGTGAGGGGGCAGAGCCATGG + Intronic
946652581 2:221909699-221909721 CCAGTGTGGTACATGAGCCCTGG + Intergenic
947625830 2:231618056-231618078 CCAGTGCTGTAGCAGAGGCTCGG + Intergenic
947992644 2:234498602-234498624 CCAGTGAGGTAACAAGGCCTAGG + Intergenic
948298600 2:236884926-236884948 CTACAGAGGAAGCAGAGCCCAGG + Intergenic
948335153 2:237201713-237201735 CCAGTGAGGCAGCTGGGCTCTGG + Intergenic
948723495 2:239918256-239918278 CCACTGAGGTCCCACAGCCCTGG + Intronic
948866149 2:240775802-240775824 CCAGGGTGGGATCAGAGCCCTGG + Intronic
1168771939 20:421110-421132 CCAATGAGGTATCAGAGCACAGG - Intronic
1171365272 20:24618312-24618334 CCAGTGAGGGCAGAGAGCCCAGG + Intronic
1172474516 20:35226859-35226881 CCCGGGAGGCAGCAGAGCGCGGG - Exonic
1172757571 20:37297612-37297634 GCAGTGAAGCAGCAGAGCCAAGG + Intronic
1173615208 20:44398997-44399019 CCAGGCAGGTGGCAGAGGCCTGG + Intronic
1173644044 20:44622624-44622646 CCAGTGAGGTAGCTGGACCAGGG + Exonic
1174257501 20:49268862-49268884 CTAGTGAGGTTGCAGAGCAAAGG + Intronic
1175057824 20:56214145-56214167 CCAGTGAGGGAGTAGAGACATGG - Intergenic
1175798799 20:61789103-61789125 CCAGGGAGGTCCCTGAGCCCTGG - Intronic
1176051286 20:63120885-63120907 CCAGGCAGGTGGCAGAGCCTGGG - Intergenic
1176615718 21:9027034-9027056 CCAGTGAGGCAGAGGAGCCCAGG + Intergenic
1176709452 21:10136769-10136791 CCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1178164194 21:29953561-29953583 CCAGCAAGGTAGAAGAGGCCTGG - Intergenic
1179727561 21:43348817-43348839 GCAGCGAGGAAGCAGGGCCCAGG + Intergenic
1179942815 21:44650739-44650761 CCAGTGAGGGTGGAGAGTCCAGG + Intronic
1180056215 21:45360398-45360420 CCAGGGAGGCAGGAGGGCCCGGG + Intergenic
1180122561 21:45763666-45763688 GCAGGGAGGTGGCAGAGCCAGGG + Intronic
1180293551 22:10864064-10864086 TCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1180496356 22:15893479-15893501 TCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1180671584 22:17557786-17557808 AGAGTGAGGTACCTGAGCCCTGG - Intronic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1181370112 22:22409135-22409157 CCACAGAGGAAGGAGAGCCCTGG + Intergenic
1181969168 22:26677269-26677291 CCAGTGAAGTATAAGATCCCTGG - Intergenic
1182691217 22:32164811-32164833 CCACTGAAGAAGCAGAGCTCAGG - Intergenic
1182803301 22:33049798-33049820 CCTGTGAGCTAGAAGACCCCAGG + Intronic
1183687019 22:39367031-39367053 TCAGTGAGGGACCCGAGCCCAGG - Intronic
1184894825 22:47400811-47400833 CCAGGCAGGAGGCAGAGCCCAGG - Intergenic
1184939410 22:47750218-47750240 CAAGGGAGGCAGCAGAGCCAGGG + Intergenic
950184148 3:10934784-10934806 CCAGCGAGGTCCCAGAACCCAGG + Intronic
950986581 3:17376524-17376546 CCAGTGAGTCTGCACAGCCCAGG - Exonic
954200897 3:49022501-49022523 CGAGTGCGGGAGCAGAGCGCAGG - Exonic
954235283 3:49252325-49252347 CCAGTGGGGTGGCACAGCCCTGG + Intronic
954737021 3:52715094-52715116 CCAGGGAGGGAGCAAAGGCCGGG + Intronic
954810507 3:53244369-53244391 CAAGTGAAGAAGCTGAGCCCCGG - Intronic
955523832 3:59801151-59801173 GCATTGAGGTAGCACAGGCCTGG - Intronic
956048872 3:65225780-65225802 CCAGTTTGGAAGCAGAACCCTGG - Intergenic
956773872 3:72549316-72549338 ACAGAGAGGCAGCAGAGCACAGG + Intergenic
957982861 3:87533391-87533413 CCAGTCTGGTGCCAGAGCCCAGG + Intergenic
958495041 3:94834315-94834337 CCAGTGAGGTTGCAGAGAAAAGG + Intergenic
961356802 3:126344593-126344615 CCAGTGGGGTAGATGAGGCCAGG - Intronic
963138581 3:141929725-141929747 TCAGTGTGGTCTCAGAGCCCGGG + Intergenic
963271535 3:143290295-143290317 CAAGTGAGGTAGGGGAGGCCTGG - Intronic
964744958 3:160003667-160003689 CAAGGGAGAAAGCAGAGCCCAGG - Intergenic
965492797 3:169360661-169360683 CCATTGATGGAGAAGAGCCCAGG + Intronic
968080890 3:195846311-195846333 CCTGTGAGGGAGCAGGGCCCAGG + Intergenic
968432306 4:566168-566190 GCAGTGAGGGGACAGAGCCCTGG - Intergenic
968952921 4:3703794-3703816 CCAGGGAGGCAGGAGAGTCCTGG - Intergenic
969420514 4:7091799-7091821 TCAGTGATGTAGAAGAGCCTGGG + Intergenic
969447950 4:7256073-7256095 CAAGTGAGGAGGCAGAGACCTGG - Intronic
971425765 4:26513783-26513805 CCAGTGAGGATGCAGAGACAGGG - Intergenic
972246969 4:37255487-37255509 CCAGTGAGTGAGCAAAGCCTGGG + Intronic
975695343 4:77007434-77007456 CCAGTGAGCTGGAAGAGCACAGG - Intronic
975848843 4:78551607-78551629 CCGGTGAGGGAGCAGAGCTGGGG + Exonic
977845810 4:101765235-101765257 CCAGTGAGGTTGCAGAGAAAAGG - Intronic
980153582 4:129079087-129079109 CCAGTGTTGGAGGAGAGCCCTGG - Intronic
980158529 4:129133826-129133848 CCAGCGAGGCAGAAGAGCCCAGG - Intergenic
981127592 4:141124248-141124270 CAGGTGAGGTGTCAGAGCCCTGG - Intronic
981943883 4:150318039-150318061 CCAGTGAGGACACTGAGCCCAGG + Intronic
981944072 4:150320235-150320257 CCAGTGAGGACACTGAGCCCAGG - Intronic
985039802 4:185878820-185878842 GCTGGGAGGGAGCAGAGCCCAGG - Intronic
986458011 5:7940015-7940037 CCAGTGAGTTCCCAGAGCTCAGG + Intergenic
987074499 5:14368050-14368072 CCAGTGAGGCCGTAGAGCCAAGG - Intronic
987123013 5:14785275-14785297 CCAGTGTGGGAGCTGAGGCCTGG + Intronic
990528736 5:56653594-56653616 CCATTGAGGCAGCAGGGCCAAGG - Intergenic
991505439 5:67319077-67319099 ACAGTGAGGCAGCTGAGGCCCGG - Intergenic
991568978 5:68034762-68034784 CCAGACAGGCAGCAGAGGCCTGG - Intergenic
992202750 5:74400318-74400340 CCAGGGAGGTAGCAAGACCCAGG + Intergenic
994318342 5:98360517-98360539 ACAGTGAGGCAGCAAAGTCCAGG + Intergenic
997286308 5:132681252-132681274 CCAGTGAGGCAGGAGAACACTGG + Intronic
999959558 5:156739758-156739780 CTAGTGAGGAATCAGAGACCTGG + Intronic
1000026096 5:157360462-157360484 CCAGTGAGCTGGCAGAGTACTGG + Intronic
1000880067 5:166687050-166687072 CCAGTTAGATAGCTCAGCCCTGG + Intergenic
1001074801 5:168617913-168617935 CAGGTGAGGTATCAGAGCTCTGG - Intergenic
1001598469 5:172913773-172913795 CCAGTGAGGTGACAGAGGGCAGG + Intronic
1001818953 5:174694625-174694647 CTGGTGAGCTGGCAGAGCCCTGG + Intergenic
1002043146 5:176528699-176528721 CCACTGAGGGAGCGGACCCCTGG + Exonic
1002379141 5:178812859-178812881 CTGGTGAGGTAGCAGAGGACAGG + Intergenic
1002427452 5:179184726-179184748 CCAGTGGGGAAGGAGAGACCAGG - Intronic
1004363014 6:14987606-14987628 CCTGTAGGGTATCAGAGCCCAGG - Intergenic
1006383769 6:33717291-33717313 GCAGAGAGGCAGCAGATCCCTGG - Intergenic
1006750340 6:36372995-36373017 CCAGTGGGGTAGAGGAGACCAGG + Intronic
1006945806 6:37783766-37783788 CTAGAGAGGAAGCACAGCCCGGG - Intergenic
1007111433 6:39315335-39315357 CCAGAGAGCCAGCAGATCCCAGG - Exonic
1014376474 6:120681070-120681092 CCAGTGAGGTGTCAGAGCTCTGG + Intergenic
1016806851 6:148220224-148220246 CCATTGAGGAAGCAGAGACGGGG - Intergenic
1017802460 6:157909711-157909733 ACTGTGTGGTAGCAGATCCCAGG + Exonic
1018373126 6:163186783-163186805 CCAGGGAGGGAGCAGAGCGGTGG - Intronic
1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG + Intronic
1019502729 7:1372925-1372947 CCAGTGAGGAAGGAGAGCGGAGG + Intergenic
1019506938 7:1396054-1396076 CCACTGAGGAAGCAGATCCCTGG + Intergenic
1019754810 7:2761216-2761238 GCCGGGAGGTAGCAGAGCCGGGG - Intronic
1019933562 7:4239699-4239721 CCAGAGCTGTAGCTGAGCCCAGG + Intronic
1020637475 7:10714162-10714184 CCAGGCAGGTAGCAGAGCTGGGG + Intergenic
1021573054 7:22084265-22084287 GCACTTAGGTAGCAGAGCCTGGG - Intergenic
1021622808 7:22564809-22564831 TCTCTGAGGTAGCAGTGCCCTGG - Intronic
1021798884 7:24284690-24284712 CCAGGGAGGTGGCAGGGCGCGGG - Intronic
1022421295 7:30226191-30226213 CCAGGGAGGGAGCTGAGGCCTGG - Intergenic
1023048324 7:36230326-36230348 GCAGTGATGTGGCAGAGGCCCGG - Intronic
1024611164 7:51065575-51065597 CCAGAAAGGTGGCAGGGCCCAGG + Intronic
1026243386 7:68596942-68596964 CCAATGAGGTATCAGAACCCAGG - Intergenic
1028602508 7:92617316-92617338 CCAGAGAGGCAGCAGCTCCCTGG - Intronic
1029372381 7:100158100-100158122 CCCCTGAGGTAGCAGGGCCCGGG + Exonic
1029703155 7:102260955-102260977 CCTGTGAGGTGGCAGAGGCCTGG + Intronic
1030297581 7:107944381-107944403 CCAATGAGCTAGCAGAGCTTCGG + Intronic
1031035723 7:116785576-116785598 CCAGTGTGGGAGCTGAGGCCTGG - Intronic
1031391404 7:121219222-121219244 CCAGTGAGGTAGAAAACCCAAGG - Intronic
1032747459 7:134801668-134801690 CCAGTGCCGTAGCACAGCCACGG + Intronic
1033761234 7:144438765-144438787 CCAGTGAGGAAGCTGAGTCCAGG - Intergenic
1035334030 7:158114192-158114214 CCACTCAGGTCCCAGAGCCCTGG - Intronic
1036258569 8:7223208-7223230 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036308050 8:7616300-7616322 CCAGGAAGGTAGGAGAGGCCAGG - Intergenic
1036310624 8:7681804-7681826 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036622868 8:10437496-10437518 TCTATGAGGAAGCAGAGCCCTGG + Intergenic
1036892052 8:12602651-12602673 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036899598 8:12660626-12660648 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1037382331 8:18299574-18299596 GAAGTGAGGTAGCAGACCCGCGG + Intergenic
1037472592 8:19225175-19225197 CAAGTGGGGTATCAGAACCCTGG - Intergenic
1038825813 8:31000558-31000580 CCTGTGGTGTAGCAGAGCCCAGG - Intronic
1040008692 8:42642841-42642863 CCCATGAGAGAGCAGAGCCCTGG - Intergenic
1041909549 8:63073812-63073834 CAAATGAGTTAGAAGAGCCCAGG + Intronic
1044707497 8:95023287-95023309 CCTGTGTAGTAGCAGAACCCCGG - Intronic
1044926712 8:97215392-97215414 CCAATGAGGAAGCAGAGGCTTGG + Intergenic
1045685173 8:104704065-104704087 CCACTGAGGATGGAGAGCCCTGG - Intronic
1047569332 8:126081014-126081036 CCAGAGAGATATAAGAGCCCTGG + Intergenic
1047797266 8:128270477-128270499 CAAATGAGGAAGCAGAGTCCTGG + Intergenic
1047963804 8:130030696-130030718 TCAGTGAGATAACACAGCCCAGG + Intergenic
1048000812 8:130378053-130378075 CCAGTGAGGTAAAAGAGCTCTGG + Intronic
1048878407 8:138854476-138854498 CCTGGGAGGTAGCAGAGGCAGGG + Intronic
1049783792 8:144440911-144440933 CCAGTGAGGTTGACGAGGCCTGG - Intronic
1051834505 9:21320180-21320202 ACTGTGAAGGAGCAGAGCCCAGG - Intergenic
1052603586 9:30671206-30671228 CCAGCGAGGTAGAGAAGCCCAGG + Intergenic
1053646423 9:40122305-40122327 CCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1053759290 9:41341246-41341268 CCAGTGAGGCAGAGGAGCCCAGG + Intergenic
1054327435 9:63720207-63720229 CCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1054538146 9:66253668-66253690 CCAGTGAGGCAGAGGAGCCCAGG + Intergenic
1054695753 9:68357494-68357516 GGAGTGAGGTAGCAAAGCCGGGG - Intronic
1055316492 9:75039491-75039513 CCAGTGAGGCTGCAGATGCCAGG - Intergenic
1057418973 9:94892967-94892989 CAAGTGAGGTAGCTAACCCCTGG - Intronic
1058309520 9:103483928-103483950 GCAGGGAGGTGGCAGAGGCCTGG - Intergenic
1058876634 9:109250302-109250324 CCGGTGAGCGAGGAGAGCCCTGG - Intronic
1061382123 9:130265020-130265042 CAAGGGAGGCAGCAGAGCCCTGG + Intergenic
1062402383 9:136378263-136378285 CCAGGGAGATACCTGAGCCCAGG - Exonic
1062625108 9:137438959-137438981 GCAGAGAGGAGGCAGAGCCCTGG - Intronic
1062710931 9:137974843-137974865 CTAGGGAGGCAACAGAGCCCAGG - Intronic
1202794211 9_KI270719v1_random:105736-105758 CCAGTGAGGCAGAGGAGCCCAGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189149210 X:38687031-38687053 CCAGTGAGGTAAGAAAGCCAAGG - Intronic
1190897659 X:54637008-54637030 CCAGTGAGGTTGCAGAGAAAAGG - Intergenic
1192340330 X:70258696-70258718 CCAGTGAGCAAGTAGAGCACAGG + Exonic
1192619312 X:72661913-72661935 CCTGTGAAGTAGAAAAGCCCAGG + Intronic
1193807531 X:86012731-86012753 CAGGTGAGGTATCAGAGCCCTGG - Intronic
1195129403 X:101839081-101839103 CCAGTGAGGTGGCAGAGCCCTGG - Intronic
1195176835 X:102320748-102320770 CCAGTGAGGTGGCAGAGCCCTGG + Intronic
1195182029 X:102366345-102366367 CCAGTGAGGTGGCAGAGCCCTGG - Intronic
1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG + Intergenic
1195254760 X:103080866-103080888 CCAGTGAGGTAGCAGAGCCCTGG - Intronic
1196005820 X:110836075-110836097 TCAGTGTGGTTGCAGAGTCCAGG + Intergenic
1197689519 X:129482501-129482523 CTAGTGAAGTAGCAGAATCCTGG - Intronic
1199303201 X:146236783-146236805 TCACGGAGGTAGAAGAGCCCAGG + Intergenic
1199844350 X:151679928-151679950 CCAGTGAGTCAGCAGAGACAGGG - Intergenic
1201149103 Y:11085689-11085711 CCAGTGAGGCAGAGGAGCCCAGG + Intergenic