ID: 1195255193

View in Genome Browser
Species Human (GRCh38)
Location X:103082995-103083017
Sequence CAGCCATACCTGGGTAAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195255185_1195255193 26 Left 1195255185 X:103082946-103082968 CCATCTCACACAGACACCTCTGC 0: 1
1: 0
2: 4
3: 25
4: 346
Right 1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 103
1195255187_1195255193 4 Left 1195255187 X:103082968-103082990 CCCTCATCTACCATAGAATTACT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 103
1195255186_1195255193 10 Left 1195255186 X:103082962-103082984 CCTCTGCCCTCATCTACCATAGA 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 103
1195255188_1195255193 3 Left 1195255188 X:103082969-103082991 CCTCATCTACCATAGAATTACTT 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 103
1195255189_1195255193 -6 Left 1195255189 X:103082978-103083000 CCATAGAATTACTTTCTCAGCCA 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195255193 Original CRISPR CAGCCATACCTGGGTAAAAT GGG Exonic
900925191 1:5701177-5701199 CAGCCATGCCCGGCTAAATTTGG - Intergenic
904685271 1:32255118-32255140 CAGCCATACATGGGAAAATCTGG - Intronic
905648133 1:39639114-39639136 CATCCAAACTAGGGTAAAATTGG + Intronic
906212815 1:44021525-44021547 CACCCAAACCTGGGTAAAGGGGG + Intronic
906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG + Intronic
907151332 1:52291106-52291128 CAGCCAGACCTGGGTAATCCTGG + Intronic
907585369 1:55612095-55612117 CAGGCAGACCAGGGTAAAGTAGG - Intergenic
912183034 1:107241364-107241386 CAGCCAAGCCTGGGTATAAATGG + Intronic
917074534 1:171190726-171190748 TAGACAAATCTGGGTAAAATTGG - Intronic
923857237 1:237858425-237858447 CAGCTATACCTCAGTAAAGTTGG + Intergenic
924534685 1:244924904-244924926 CAGTCAGTCCTGGTTAAAATAGG - Intergenic
1066379785 10:34891395-34891417 CAGCCAGCCATGGGCAAAATTGG - Intergenic
1070505729 10:77111230-77111252 CAGGCATATTTGAGTAAAATTGG - Intronic
1071250195 10:83810071-83810093 CAGCCATACCTGAACTAAATTGG - Intergenic
1071310129 10:84335441-84335463 CAGCCCAGCCTGGGTAACATGGG - Intronic
1077438279 11:2555431-2555453 CAGCCCTGCCTGGGGAAGATGGG + Intronic
1079161090 11:17994970-17994992 CAGCCAAGCCTGGGTAAACTCGG + Intronic
1081137634 11:39458782-39458804 CAGAAATAACTGGGTAAAAGTGG + Intergenic
1082833119 11:57634090-57634112 CATCCTTCCCTGGGCAAAATGGG - Intergenic
1086745835 11:90425756-90425778 TAGCTACACCTGGGTTAAATAGG - Intergenic
1088248578 11:107842670-107842692 CCGCCATACCTGGCTAATTTAGG + Intronic
1092642535 12:10531407-10531429 CAGACATTCATGGGAAAAATGGG + Intergenic
1093805770 12:23431372-23431394 CAGCCATGCATGGGAAAAAAGGG + Intergenic
1093996205 12:25645600-25645622 CAGTGATACCATGGTAAAATGGG + Intronic
1098065565 12:66612457-66612479 CAGACAAGCCTGGGTAACATAGG + Intronic
1099018955 12:77379806-77379828 CAGCTAGACATGGGTGAAATTGG + Intergenic
1100296080 12:93262850-93262872 CAGCCTTTCCTAGGTTAAATTGG + Intergenic
1100481659 12:94985121-94985143 CAGACCTGCCTGGGTAACATAGG + Intronic
1104517633 12:129442729-129442751 AAGTCATACTTGGGTAAGATTGG + Intronic
1111696412 13:91630412-91630434 CTTCTATACCTGGGTAGAATGGG - Intronic
1114680877 14:24482563-24482585 CTGGCTTCCCTGGGTAAAATGGG - Intergenic
1120544269 14:85791513-85791535 CAGGCATACCTGGGAGAGATTGG - Intergenic
1125883070 15:43210003-43210025 CAGCAAGCCCTGGGTAAGATGGG + Intronic
1131056231 15:89377005-89377027 CAGGCATCTCTGGGTGAAATGGG + Intergenic
1143442721 17:6987951-6987973 CAGTCATACCTCAGTAAAGTTGG - Intronic
1143771804 17:9173751-9173773 CAGCCCTCCCTGGGGAAACTTGG + Intronic
1151316425 17:73325316-73325338 CAGCCAACCCTGGGTTCAATTGG - Intergenic
1154165967 18:12014727-12014749 CAGCAGTGCCTGGGCAAAATCGG - Intronic
1164426614 19:28147493-28147515 CAGCCATGCAAAGGTAAAATTGG + Intergenic
1165435107 19:35791065-35791087 CAGCCAGGCCTGGCTAAAGTGGG - Intergenic
1166370811 19:42299761-42299783 AAGCCATCCCTGGGCAAAAAAGG + Intronic
1168159199 19:54497804-54497826 CAGCCCATCCTGGGTAAAATCGG + Intergenic
926831490 2:16967319-16967341 CTGGCATAAATGGGTAAAATTGG + Intergenic
931707660 2:64960714-64960736 CCTCGATACCTGGATAAAATTGG + Intergenic
936925600 2:117733600-117733622 TAGCCACACCTGGGTAAATTAGG - Intergenic
937085338 2:119167963-119167985 AAAGCATCCCTGGGTAAAATTGG + Intergenic
941688135 2:168468720-168468742 CAGCCCTAACTAGGGAAAATGGG - Intronic
942359055 2:175152802-175152824 CAGCCATACAAATGTAAAATAGG + Intronic
943100722 2:183482705-183482727 CAGCTATACTTGGACAAAATAGG - Intergenic
944765998 2:202864864-202864886 CAGCCACACCTGGCTAATTTTGG - Intronic
948735121 2:239998593-239998615 CAGCCCTACCAGGGTACGATGGG + Intronic
1169139837 20:3221558-3221580 CAGCCACACCCGGGACAAATTGG - Intronic
1169632938 20:7653615-7653637 CAGTCACACCAGGGTAAAAATGG - Intergenic
1171024673 20:21618762-21618784 CAGCTATACCTCAGTAAAACTGG + Intergenic
1171181869 20:23096945-23096967 CAACCATACCTGGGGAAGACTGG + Intergenic
1174658256 20:52190023-52190045 TAGCTAGACCTGGGGAAAATTGG - Intronic
1175577894 20:60076198-60076220 GAGGCATACCAGAGTAAAATTGG - Intergenic
1177365971 21:20137299-20137321 CAGCGAAACCTGGGTAAATATGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1180147904 21:45931461-45931483 CAGCCACAGCAGGGTTAAATTGG + Intronic
951741409 3:25928803-25928825 CAAGCATATATGGGTAAAATGGG + Intergenic
957802824 3:85107101-85107123 ATGCCATACCTTTGTAAAATGGG - Intronic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
962601515 3:136994750-136994772 CAGTCCTACCTGGGTAACCTGGG + Intronic
962751304 3:138436167-138436189 CAGCCATAACTGAGTACAACAGG + Intronic
964313435 3:155418504-155418526 CTCCCATTCCTGGGGAAAATAGG - Intronic
968990718 4:3909722-3909744 CCGCCAGAGCTGGGTAACATGGG + Intergenic
969298935 4:6285855-6285877 CAGCCAGCCTTGGGTGAAATGGG + Intronic
970971575 4:21990337-21990359 CAGACCAACCTGGGTAACATAGG + Intergenic
975390985 4:73817022-73817044 CAGACATAACTGGGGAAACTTGG + Intergenic
977879036 4:102183406-102183428 GAGGAATACCTGGGCAAAATTGG + Intergenic
978682552 4:111399399-111399421 CATCTCTACTTGGGTAAAATCGG - Intergenic
986498385 5:8371623-8371645 GAGCCAAACCTGTGTCAAATGGG - Intergenic
989716820 5:44473127-44473149 CAGTAATGCCTTGGTAAAATAGG + Intergenic
994538873 5:101068968-101068990 CAGCCATAGATGTGTAATATTGG - Intergenic
997791851 5:136769074-136769096 CAGCCAGACCTGGGTTAAGTGGG + Intergenic
1005010321 6:21329482-21329504 CAGCCACAGCTGGATAAAAAGGG - Intergenic
1006300081 6:33189311-33189333 CACCCATACCTGGGAAAAGCTGG + Exonic
1007162875 6:39806505-39806527 CAGCCATTCCTGGGCAATGTGGG - Intronic
1007359564 6:41345435-41345457 CAGCAATAACTGGATAAAAATGG - Intronic
1007509901 6:42366882-42366904 CAGGCAGATCTGGGTAACATGGG + Intronic
1008185653 6:48387481-48387503 CAGCCAAACCTTTGAAAAATTGG - Intergenic
1008661155 6:53669524-53669546 TAGCCATAACTGGCTAATATTGG + Intergenic
1010356156 6:74936354-74936376 CAGCCAAACTTGGAGAAAATAGG - Intergenic
1014371834 6:120619252-120619274 CATGCACACCTGGGTAAACTGGG - Intergenic
1017891144 6:158640415-158640437 CTGCCTTCCCTGGGTAAAATGGG - Intronic
1018498141 6:164371109-164371131 CAGACATACATGGGAAAACTAGG - Intergenic
1018709434 6:166487099-166487121 TAGCCATACCTGCGTAAAAGGGG - Intronic
1019162393 6:170077533-170077555 CAGCCATAACTGAACAAAATAGG - Intergenic
1019578801 7:1750099-1750121 CAGCCAGTCCTGGGAAAAAGAGG + Intergenic
1020954569 7:14724968-14724990 GAGCCCAACCTGGGCAAAATAGG + Intronic
1028760619 7:94492054-94492076 CAGCCAGACCTGGGGACAAGTGG + Intergenic
1030771329 7:113477857-113477879 CAGCAATTCATGAGTAAAATAGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1035818264 8:2563446-2563468 CAGCTTTCCCAGGGTAAAATGGG + Intergenic
1037597634 8:20367710-20367732 CAGCCATACCTGGGTACCAAAGG - Intergenic
1038443652 8:27588303-27588325 CAGCCCTACCTGGGTGCAGTGGG - Intergenic
1038777443 8:30543737-30543759 CAGCCTGACCTGGGTGGAATTGG + Intronic
1041483776 8:58351660-58351682 CGGTCATATCTGGGTAAATTTGG - Intergenic
1044326588 8:90865621-90865643 AAGCCATACCAGGGTAGAAGTGG - Intronic
1046274502 8:111939702-111939724 CTGCTATACCTGAATAAAATTGG - Intergenic
1046813616 8:118559327-118559349 CTGCCATCCCTGCATAAAATAGG - Intronic
1051634484 9:19169378-19169400 CAGCCTAGCCTGGGCAAAATAGG + Intergenic
1061622476 9:131820155-131820177 CAGCCATAAATGGGGAAAAGAGG - Intergenic
1185832283 X:3313845-3313867 AAGGCATTCCTGGGTAAATTGGG + Intronic
1187110723 X:16296711-16296733 CAGGCATACCTGAGAAATATTGG + Intergenic
1187182614 X:16957208-16957230 GAGGCCAACCTGGGTAAAATAGG + Intronic
1193251263 X:79293172-79293194 CAGCCAAACCTAGGAATAATTGG + Intergenic
1193422994 X:81307141-81307163 CAGCCTTACCAGGCTAACATGGG - Intergenic
1195129881 X:101841252-101841274 CAGCCTTACCTGGGTCAAAGCGG + Exonic
1195176355 X:102318571-102318593 CAGCCTTACCTGGGTCAAAGCGG - Exonic
1195182509 X:102368522-102368544 CAGCCTTACCTGGGTCAAAGCGG + Exonic
1195202241 X:102563263-102563285 CAGCCATACCTGGGTCAAAGCGG - Intergenic
1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG + Exonic
1200057442 X:153469071-153469093 CAGCCCCACCTGGGGAAGATGGG - Intronic
1201265723 Y:12204730-12204752 CTGCCATGCCTGGATAAAATTGG - Intergenic