ID: 1195269564

View in Genome Browser
Species Human (GRCh38)
Location X:103215926-103215948
Sequence AGATGGATCTACAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 280}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195269548_1195269564 30 Left 1195269548 X:103215873-103215895 CCCCTTCCCACACGCCATCCTCG 0: 1
1: 0
2: 2
3: 38
4: 532
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269554_1195269564 12 Left 1195269554 X:103215891-103215913 CCTCGTCCTCCATTTTGCTGCCT 0: 1
1: 0
2: 3
3: 29
4: 285
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269550_1195269564 28 Left 1195269550 X:103215875-103215897 CCTTCCCACACGCCATCCTCGTC 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269549_1195269564 29 Left 1195269549 X:103215874-103215896 CCCTTCCCACACGCCATCCTCGT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269560_1195269564 -8 Left 1195269560 X:103215911-103215933 CCTGCGGAAGCCTGGAGATGGAT 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269557_1195269564 3 Left 1195269557 X:103215900-103215922 CCATTTTGCTGCCTGCGGAAGCC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269556_1195269564 6 Left 1195269556 X:103215897-103215919 CCTCCATTTTGCTGCCTGCGGAA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269553_1195269564 16 Left 1195269553 X:103215887-103215909 CCATCCTCGTCCTCCATTTTGCT 0: 1
1: 0
2: 1
3: 45
4: 438
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269551_1195269564 24 Left 1195269551 X:103215879-103215901 CCCACACGCCATCCTCGTCCTCC 0: 1
1: 0
2: 1
3: 13
4: 258
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280
1195269552_1195269564 23 Left 1195269552 X:103215880-103215902 CCACACGCCATCCTCGTCCTCCA 0: 1
1: 0
2: 0
3: 23
4: 333
Right 1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG 0: 1
1: 1
2: 3
3: 24
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195269564 Original CRISPR AGATGGATCTACAGGGAAAA TGG Intronic
904959361 1:34319449-34319471 AGAGGGAACTCAAGGGAAAAAGG + Intergenic
907685188 1:56604255-56604277 AGAGGGAACTACACAGAAAACGG - Intronic
908022281 1:59910413-59910435 AGATGCAGATACAGTGAAAATGG + Intronic
909337217 1:74489410-74489432 AGCTGTATCTACAGGGACAAAGG + Intronic
909403070 1:75256280-75256302 AGGTAGACCTTCAGGGAAAAGGG + Intronic
910462200 1:87459613-87459635 AGCTGGATCTACAGGCACAGTGG + Intergenic
911372663 1:97012698-97012720 CGATGAATATACTGGGAAAATGG + Intergenic
911439223 1:97904470-97904492 AGATAGATTTACAAAGAAAATGG + Intronic
911561672 1:99414062-99414084 AGAGTCATATACAGGGAAAAAGG + Intergenic
912671449 1:111631386-111631408 TAATGGACCTACAGGGAGAAGGG + Intronic
914750655 1:150532828-150532850 AGATGGTGCAACAGAGAAAAAGG + Intergenic
916981855 1:170146125-170146147 AGCGGGATCTAAAGGCAAAATGG - Exonic
917188408 1:172387748-172387770 AGATGGACCTACAGAAAAAGGGG + Intronic
918754954 1:188328299-188328321 AGATGGATCAATAAGAAAAATGG + Intergenic
920266120 1:204724486-204724508 AGATGGACATAGACGGAAAAGGG - Intergenic
920407986 1:205733802-205733824 AGATAGATATACAGGGAAGGAGG - Intronic
921441737 1:215195592-215195614 AAATCTATATACAGGGAAAACGG - Intronic
922069403 1:222176034-222176056 AGCTGGACTTACAAGGAAAAAGG + Intergenic
922073120 1:222215904-222215926 GGATGAATGTTCAGGGAAAAGGG + Intergenic
922516989 1:226215082-226215104 AGATGGACCTCCCGGGTAAAGGG + Intergenic
923902347 1:238340670-238340692 AGATGTATGTATAGGGAGAAGGG - Intergenic
924480433 1:244427089-244427111 AGATGCTTTTTCAGGGAAAATGG - Intronic
1062937694 10:1400454-1400476 AGATGGATTTTCTGGGAGAAAGG + Intronic
1063149856 10:3326497-3326519 AGATGGATCTCCAGGGCATCAGG - Intergenic
1063726774 10:8645687-8645709 AGACAGATCCACAGTGAAAAGGG - Intergenic
1063926488 10:10982636-10982658 AGCTGGAACTACAGGGTAATAGG - Intergenic
1064056788 10:12104711-12104733 AGATGGTTCAAGATGGAAAAAGG - Intronic
1065039980 10:21683347-21683369 CTAGGTATCTACAGGGAAAAGGG + Intronic
1065054251 10:21827627-21827649 AGAAGCATCCACAAGGAAAAAGG - Intronic
1065613995 10:27501451-27501473 AGATGGATCCACAGGGAAAAGGG + Intergenic
1065949360 10:30637892-30637914 AGATGGACCCACAGGGAAAAGGG - Intergenic
1066444513 10:35469726-35469748 AGATGGAGAGACAGGGAAATGGG + Intronic
1066658239 10:37713985-37714007 GGATGGATCTACAGGGATCTGGG - Intergenic
1067042739 10:42963663-42963685 GGATGGATCTACAGGGATCTGGG - Intergenic
1067163838 10:43849081-43849103 AGGTGGGTCTTCAGGGATAAAGG + Intergenic
1067330406 10:45310595-45310617 AGATACATGTACAGGAAAAAGGG + Intronic
1068804722 10:61182551-61182573 ACATTGATTTACAGGGCAAAGGG + Intergenic
1069113768 10:64478548-64478570 GGATGGATGTATAGGGAAAAGGG - Intergenic
1069389777 10:67921397-67921419 AAGTGGATGAACAGGGAAAATGG + Intergenic
1070535410 10:77373732-77373754 AGATAGATCCAGAGTGAAAATGG - Intronic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1071208450 10:83311423-83311445 AGATGGTTCTACAGAAATAAAGG - Intergenic
1071972638 10:90923503-90923525 AGCTGGATCAACATGGGAAAAGG - Intergenic
1072135798 10:92544510-92544532 AGCTGGAACTACAGAGAAAGAGG + Intronic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1072786696 10:98288008-98288030 ACATGGAGCAACAGAGAAAAAGG + Intergenic
1073084102 10:100877364-100877386 GCATTGATCTACAGGGGAAATGG - Intergenic
1073981426 10:109158491-109158513 TGATGTATCTCCAGGGCAAAGGG + Intergenic
1075227138 10:120639902-120639924 ATATGGCTCTACTGGGAGAATGG + Intergenic
1075277731 10:121110061-121110083 ATATGTATTTATAGGGAAAAAGG - Intergenic
1076283786 10:129274205-129274227 TGCTGGAGCTGCAGGGAAAAGGG + Intergenic
1078580554 11:12536462-12536484 AGATGGAACTGCAGTGAGAATGG - Intergenic
1079180911 11:18192729-18192751 AGATGGATCTGAAGAGAGAAAGG - Intronic
1080162500 11:29194085-29194107 AGATTGATTGGCAGGGAAAAGGG - Intergenic
1080388949 11:31826549-31826571 AGCAGGATCTGCTGGGAAAAAGG + Intronic
1080562292 11:33474986-33475008 ATATGTATCTTCAGGGAATATGG + Intergenic
1082143538 11:48638128-48638150 TTATGGATCTACACTGAAAATGG - Intergenic
1082199718 11:49351084-49351106 GGATGGATATACAGTCAAAATGG + Intergenic
1082243631 11:49894659-49894681 TTATGGATCTACACTGAAAATGG + Intergenic
1082570732 11:54735404-54735426 TTATGGATCTACACTGAAAATGG - Intergenic
1088447225 11:109945041-109945063 ACATGCATCTACAGGCAAAGAGG + Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1089099184 11:115946685-115946707 AGATGGAACTACCAGGAGAAAGG + Intergenic
1090828995 11:130408021-130408043 AGATGGATCTTCAGAGAAGGGGG - Intronic
1091101369 11:132876833-132876855 AGCTGGATCTTCAGGGGTAAAGG + Intronic
1092026129 12:5242117-5242139 AGATGATTCCACAGGGAAAAAGG + Intergenic
1092160857 12:6314794-6314816 AGCTGGAATTCCAGGGAAAAAGG - Intronic
1094273370 12:28641975-28641997 ATATGGAGCAAAAGGGAAAAGGG - Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095298466 12:40554552-40554574 AGAAGGATCTACAATGCAAAAGG - Intronic
1099432421 12:82603862-82603884 TGATGCAGCTACAGAGAAAAGGG + Intergenic
1100715906 12:97305143-97305165 AGTTGGCTGTAGAGGGAAAAAGG + Intergenic
1100870260 12:98903421-98903443 TGTTGGAACTACTGGGAAAAAGG + Intronic
1101671699 12:106881451-106881473 ACATGGATTCACAGGGAGAAAGG - Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1106179067 13:27355701-27355723 AGCTGGATCTAAAAGGGAAATGG + Intergenic
1106381660 13:29245340-29245362 AGAGAAATCTGCAGGGAAAAAGG + Intronic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1107916574 13:45157945-45157967 ACATGGATATATAGAGAAAAAGG - Intronic
1108114616 13:47113212-47113234 GCATGGATTTAGAGGGAAAATGG + Intergenic
1108618224 13:52156766-52156788 AGATAGATTAACAGGAAAAAAGG - Intronic
1108949599 13:56074363-56074385 AGATGGATATAGAAAGAAAAGGG + Intergenic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1110015722 13:70399079-70399101 AGTTGGAACTAAAGAGAAAAAGG + Intergenic
1110475908 13:75913124-75913146 AGATGGGTTTCCAAGGAAAAGGG + Intergenic
1110512654 13:76369638-76369660 AGATGGATCTACAAGAAAGAGGG - Intergenic
1111900763 13:94197075-94197097 GTATGAATCTACAGGGAGAAAGG + Intronic
1111952375 13:94719385-94719407 AAAGGGATCTACATGGAAAAAGG - Intergenic
1111997320 13:95177561-95177583 AAATGGATCTTCAGGGAAGCAGG + Intronic
1111998144 13:95184991-95185013 AAATGGATCTTCAGGGAAGCAGG + Intronic
1113112601 13:106839990-106840012 AAATGGATCTACAGGAAACCTGG + Intergenic
1113307677 13:109095940-109095962 AGATGGTTCTAGAGTGGAAAAGG - Intronic
1113662659 13:112117860-112117882 AGATGGAGCTCCAGGGCAGAGGG + Intergenic
1114271589 14:21103614-21103636 AGATGGATCGAAAGGGGAACTGG - Exonic
1114901831 14:27070903-27070925 TGATGAATCTAGAGGGAAATTGG + Intergenic
1116829142 14:49700634-49700656 ATATGGATTTAAAGGGAAGAAGG + Intronic
1116984523 14:51204698-51204720 AGCAGAATCTACAGGGGAAATGG + Intergenic
1117672584 14:58123547-58123569 AGCTGGGTCTAGAGGGACAACGG - Intronic
1119724113 14:76911667-76911689 AGAAGGATCAACAGGGCAGATGG - Intergenic
1122023297 14:98857235-98857257 AGGTGGATTAACAGGGAAGAGGG - Intergenic
1122059036 14:99124487-99124509 GGATGCATCTACAAGGAAATAGG - Intergenic
1122377684 14:101276880-101276902 AAATGTATCTACAGGAAGAAAGG + Intergenic
1123791365 15:23723922-23723944 AGATAAATCTACAGAGAAAAGGG - Intergenic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1125186724 15:36939453-36939475 AAATGGATCCAAAGAGAAAATGG - Intronic
1127215175 15:56816329-56816351 ACGTGGATCTAAAGGGCAAATGG + Intronic
1127876681 15:63117867-63117889 AGAAGGATATACAGGAAAAGAGG - Intergenic
1128355867 15:66926002-66926024 AAATGGATCCACAGGCCAAAGGG + Intergenic
1128561409 15:68670511-68670533 AGATGGATCAGAAGTGAAAAGGG + Intronic
1129736723 15:77970666-77970688 AGAAGGACCTACAGAGAAAAGGG - Intergenic
1129849352 15:78782967-78782989 AGAAGGACCTACAGAGAAAAGGG + Intronic
1130252945 15:82312786-82312808 AGAAGGACCTACAGAGAAAAGGG - Intergenic
1131179540 15:90230573-90230595 AGAAGGGTCTAAAGGGAGAAGGG - Intronic
1131307287 15:91256451-91256473 AGATGGATAACCAGGGAAGAGGG - Intronic
1131312544 15:91304066-91304088 GGAGGTATCCACAGGGAAAATGG + Intergenic
1131627464 15:94136935-94136957 AGATGTATCTGCAGGGAATGAGG - Intergenic
1132854079 16:2037064-2037086 GGACGGATCTCCAGGGAGAAGGG - Intronic
1134453422 16:14377238-14377260 GGGTGGATCTCCAGGGTAAAGGG + Intergenic
1137968078 16:52956580-52956602 AGATGGACATACAGGAAGAATGG + Intergenic
1138814928 16:60193110-60193132 AGATGGCTATTCAGGGAAACAGG + Intergenic
1140660624 16:77188945-77188967 AGATTGTTTTCCAGGGAAAATGG - Intergenic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1143383429 17:6510353-6510375 AGAGGGAGCTGCAGGGACAAAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144388045 17:14768375-14768397 AAAGGGCTCTACAGGGAAATTGG + Intergenic
1145416041 17:22714910-22714932 GGATGGTCCCACAGGGAAAAAGG - Intergenic
1148659505 17:49317320-49317342 AAATGTATCTAAAGGGGAAAAGG - Exonic
1150511996 17:65763910-65763932 ATATGGAACTGCAGTGAAAAAGG + Intronic
1150657558 17:67050164-67050186 AGATGGACCAGTAGGGAAAATGG - Intronic
1151358530 17:73574497-73574519 AGTTGCAGCTACTGGGAAAAAGG - Intronic
1151547817 17:74804082-74804104 AGACTGATCTACAGGATAAAAGG - Intronic
1152513235 17:80804519-80804541 ACATAGATCTACAGAGACAAAGG + Intronic
1153334927 18:3913425-3913447 TTATGGAACTACAGGTAAAATGG + Intronic
1153626416 18:7025728-7025750 AGAGGAATCAAGAGGGAAAACGG + Intronic
1155669522 18:28351755-28351777 AGATTGATTAACAGGGGAAAAGG - Intergenic
1157102143 18:44740872-44740894 GGATGGCTCTTTAGGGAAAAAGG + Intronic
1157681442 18:49610545-49610567 AGATGGATTAACAGGAAAAAAGG + Intergenic
1160107982 18:75995864-75995886 AGAGGAATCTCCAGGGAATATGG - Intergenic
1161899215 19:7105299-7105321 AGATGGATATACAGACAAATGGG + Intergenic
1164790760 19:30978410-30978432 ACATGGATCTACATACAAAATGG - Intergenic
1164945584 19:32290561-32290583 AGATGGATCTACATGGGCATGGG + Intergenic
1165156977 19:33795212-33795234 AGTTCGAACTACAGGAAAAAGGG - Intergenic
1165831477 19:38732743-38732765 AGATGGAGCCACAGGGAGATGGG - Intronic
1166287470 19:41840437-41840459 AGATGCCCCTACAGGGAAACTGG + Intronic
1166287964 19:41844125-41844147 AGCTGGCTGTACAGAGAAAAGGG + Exonic
1166498678 19:43325294-43325316 AGAAGGAAATACAGGGAAATGGG + Intergenic
1167477430 19:49709147-49709169 AGATGGATTTGGAAGGAAAATGG - Intronic
1167762264 19:51457300-51457322 AGCTGCAAATACAGGGAAAATGG + Intronic
925427662 2:3763675-3763697 AAATGGCTTTACAGAGAAAATGG - Intronic
927507513 2:23624064-23624086 AGATGTGTCTCCAGGGAGAATGG + Intronic
929117053 2:38453336-38453358 AGATTAATCTACCTGGAAAATGG + Intergenic
929445447 2:41997415-41997437 AGAGGGATCAAGAGGGAAATAGG + Intergenic
929844194 2:45504733-45504755 AGATGGCTCGAGGGGGAAAAGGG + Intronic
930292481 2:49512408-49512430 ATATTCATCTCCAGGGAAAAGGG - Intergenic
930993053 2:57683691-57683713 AGATAAATCTAAAGGGAAAAAGG + Intergenic
931231342 2:60377420-60377442 ATATGAAGCTACCGGGAAAAAGG - Intergenic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
934743812 2:96745193-96745215 AGATGATTCCACAGAGAAAAAGG - Intergenic
935308490 2:101759831-101759853 AGACGGATGGAAAGGGAAAAGGG - Intronic
935599645 2:104909908-104909930 AAATAGATTTTCAGGGAAAATGG - Intergenic
938502404 2:131836930-131836952 AGATGGTCCCACAGGGAATAAGG - Intergenic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
940657311 2:156503605-156503627 ATAAGTATTTACAGGGAAAATGG + Intronic
940896531 2:159086436-159086458 AGTTGGAGCTACATGGACAAGGG + Intronic
942277237 2:174332422-174332444 AGCTGGAACTACGGGGAAAACGG + Intergenic
942670194 2:178366920-178366942 CCATGGACCTACAGGGTAAAAGG - Intronic
943669007 2:190640998-190641020 GGACAGATCTGCAGGGAAAAGGG - Intergenic
946931276 2:224674028-224674050 AGATGAAAGAACAGGGAAAAGGG + Intergenic
1170971501 20:21121211-21121233 AGATGGATAAACATGGAACAGGG - Intergenic
1171045080 20:21802900-21802922 AAATGAATGTAAAGGGAAAATGG + Intergenic
1173665188 20:44757971-44757993 GGATGGATCAACAGGCAAAGGGG + Intronic
1173908139 20:46643564-46643586 AGATGGATCAGCAAGGAAACGGG + Intronic
1174107274 20:48171691-48171713 AGAACGATGTACAGAGAAAAAGG - Intergenic
1174163426 20:48567789-48567811 AGTTGGATTCACAAGGAAAAGGG + Intergenic
1174244860 20:49170907-49170929 AGATGGATATACAGATACAAAGG + Intronic
1174755050 20:53149914-53149936 AAATGGATCTCCAGGGATCAGGG + Intronic
1177129241 21:17236415-17236437 AAATTGATCTGAAGGGAAAATGG - Intergenic
1178764312 21:35434895-35434917 AGACAGATTAACAGGGAAAATGG - Intronic
1178797457 21:35757961-35757983 GGATGAAGCCACAGGGAAAAAGG + Intronic
1179065367 21:38019774-38019796 AGAAGGAACTACAGGAAGAAGGG + Intronic
1180973732 22:19832553-19832575 AGATAGAGATACAGAGAAAAAGG + Intronic
1181662139 22:24359487-24359509 AGATGGATATGAAGGTAAAAAGG - Intronic
1182915244 22:34023401-34023423 TCATGGATTTACAGGTAAAATGG - Intergenic
953672120 3:44972027-44972049 AAACAGATCTACAGGCAAAACGG + Intronic
955454795 3:59108098-59108120 GAATGGATCTGAAGGGAAAAGGG + Intergenic
955720262 3:61872923-61872945 AGATGGATCTCAAAGGTAAAAGG - Intronic
955768099 3:62365918-62365940 AGAGGGAAGTGCAGGGAAAAGGG + Intergenic
956471662 3:69573531-69573553 ATTTGGATCTGCAGGGGAAATGG + Intergenic
958568733 3:95851798-95851820 AGACTCATCTACATGGAAAATGG - Intergenic
958815171 3:98906096-98906118 AAATTAATCTATAGGGAAAAGGG + Intergenic
958960516 3:100505264-100505286 AGAAGCAGCTACATGGAAAATGG + Intronic
959190238 3:103102639-103102661 AGATAGGTCTTCAGGAAAAAAGG - Intergenic
959383285 3:105669189-105669211 ATATGGATTTGCAGGGAAAAGGG - Intronic
959943246 3:112101716-112101738 AGATGGAAGGACAGGTAAAAAGG - Intronic
960300388 3:115996385-115996407 AGAGAGATCTACAGGGAATTGGG + Intronic
960312422 3:116132667-116132689 AGAGAGAACTAAAGGGAAAAAGG - Intronic
961026105 3:123559332-123559354 AAATTTATCTAGAGGGAAAAAGG + Intronic
962915522 3:139899609-139899631 AGATGGAACTACTAGAAAAATGG + Intergenic
967395375 3:189002638-189002660 ACATGGAGCTCCAGGGAGAATGG - Intronic
967613495 3:191536714-191536736 AGATGGATATATAGGTAAAGAGG + Intergenic
967821435 3:193842735-193842757 AGATGGTGCTGCAGGGAACAAGG - Intergenic
969303717 4:6312775-6312797 AGATGGATTAACTGGGAAACAGG + Intergenic
972644227 4:40952958-40952980 AGATGGGTTTACAGCCAAAAAGG + Intronic
973910793 4:55578220-55578242 ACATGGATGTACAGGGACAGAGG - Intronic
975299199 4:72769639-72769661 ATATGGATTTACTGAGAAAATGG + Intergenic
976449801 4:85175263-85175285 ATATGGATCTATTGGGTAAATGG - Intergenic
977208721 4:94193576-94193598 AGATGTATATATAGAGAAAAAGG - Intergenic
977219921 4:94326865-94326887 AGATATATCTATAGGAAAAAGGG - Intronic
978602639 4:110444739-110444761 AGATGAATCTTAAGGTAAAAAGG + Intronic
979535587 4:121816558-121816580 AGATGGATCTCTAATGAAAAAGG - Exonic
981008146 4:139896843-139896865 GGATGGTTCTACAGGGAAAGGGG + Intronic
981310287 4:143291325-143291347 AGATAAATCTGCAGGGAAAAAGG + Intergenic
982521476 4:156421975-156421997 TCATGGATCTACAGATAAAAAGG + Intergenic
982612861 4:157598843-157598865 AGATAGTTCTGTAGGGAAAAGGG - Intergenic
983188551 4:164729092-164729114 AGAGAGATAGACAGGGAAAAGGG - Intergenic
983354863 4:166644073-166644095 AGATTGGTCTAGAGGGGAAAGGG - Intergenic
983784039 4:171709874-171709896 AGATGGATCTGCAGAGAACTAGG - Intergenic
984686174 4:182670947-182670969 ATATACATCTTCAGGGAAAAGGG + Intronic
990168566 5:53021610-53021632 AGAAGGATTGACAGGGAAGAGGG - Intronic
991281657 5:64921504-64921526 AGAAGGATCTACCAGGCAAATGG - Intronic
991631004 5:68656333-68656355 GGATGGGTCTCCAGGGAAAGGGG - Intergenic
992625041 5:78629007-78629029 AGAATGATTTATAGGGAAAAGGG + Intronic
992701149 5:79343082-79343104 AGAGGGATCCACTGGGAAGAGGG + Intergenic
995803380 5:116024046-116024068 AAATGGATCTATAGTGACAAAGG + Intronic
996857583 5:128027059-128027081 ATGTGGTCCTACAGGGAAAATGG + Intergenic
997351458 5:133234223-133234245 AAATAGAACTAAAGGGAAAATGG + Intronic
998579465 5:143356017-143356039 AGATAGATCAACAGAGAAAGAGG + Intronic
1000427062 5:161103738-161103760 AGATGAATCTTCAGGGAAAAGGG + Intergenic
1001319407 5:170668131-170668153 AGCTTCATCTTCAGGGAAAAGGG - Intronic
1001330960 5:170762028-170762050 AGATGGATCCACAGGCACAAAGG + Intergenic
1001505973 5:172280916-172280938 AGATGGATTCAGAGGGAAAAAGG + Intronic
1002833354 6:844286-844308 AGAGGTATTTCCAGGGAAAATGG + Intergenic
1003020922 6:2508774-2508796 GGATGGATGGACAGGGAGAAGGG + Intergenic
1003123998 6:3340711-3340733 AGATGGGGCTACTGGGAAAAGGG + Intronic
1003753130 6:9084576-9084598 AAATGGATCTACATAGAAAAGGG - Intergenic
1004325725 6:14672462-14672484 GGACAGATCTACAGGGAAAGTGG + Intergenic
1004763325 6:18695827-18695849 AGATGGATCTAACTGGAAAGTGG + Intergenic
1004938737 6:20533480-20533502 ATATGGATAAACAGAGAAAAGGG + Intergenic
1005301984 6:24480064-24480086 AGATGGAATGAAAGGGAAAAAGG + Intronic
1005717194 6:28561128-28561150 AGATGGGTCTAAAGGGAACTTGG - Intergenic
1006333040 6:33405689-33405711 AGATGGAGGTAGAGGGAGAAAGG + Intronic
1007511715 6:42379302-42379324 AGATGGATCCACATGGCCAATGG + Intronic
1007786007 6:44279686-44279708 AAATGCATCTACAGGGATGAGGG + Exonic
1008747511 6:54690784-54690806 AGATGCATTTACACGAAAAAAGG - Intergenic
1008981288 6:57486798-57486820 AGATGGATGTCTGGGGAAAATGG + Intronic
1009313755 6:62190975-62190997 ATATGGATTTTCAGGGAAACTGG - Intronic
1011243168 6:85294556-85294578 AAGTGAATCTACAGGTAAAAGGG - Intergenic
1011280871 6:85676236-85676258 AGAAGGAGCTACAGGAAAAGCGG + Intergenic
1011759602 6:90547525-90547547 AGAGGGAGCTACAGGGGTAAGGG + Intronic
1013724480 6:113076789-113076811 TGATGGATGTAGAGGGGAAAGGG + Intergenic
1013861262 6:114638099-114638121 TGATGGAGCTACATAGAAAAAGG - Intergenic
1014509207 6:122300326-122300348 AGATAGACCTGCAGGGGAAAAGG + Intergenic
1015156821 6:130105923-130105945 ATATGGATTTACAGCCAAAAAGG - Intronic
1015258464 6:131207279-131207301 AGATGGAGCAACAAGGACAATGG + Intronic
1016271616 6:142296764-142296786 AGACAGATCAACAGGAAAAAAGG + Intergenic
1016278782 6:142387835-142387857 AGAAGTATCTAAATGGAAAATGG + Intronic
1016508263 6:144809798-144809820 AGATGAAGCTAAGGGGAAAAGGG + Intronic
1017013034 6:150077064-150077086 ATATGGATGTACAATGAAAAAGG + Intergenic
1017284839 6:152662399-152662421 ACATGGAACCACAGAGAAAAAGG + Intergenic
1017688119 6:156933789-156933811 AGATGTATTTAAAGGGAAGAAGG + Intronic
1018577886 6:165278443-165278465 AGCTGGATATAGAGGGAAAGGGG - Intergenic
1020372190 7:7444417-7444439 AGATGGAGCTGCAGGGAAGAAGG - Exonic
1021669565 7:23021558-23021580 AGATGAATCTAAAGGGTCAAAGG + Intergenic
1022231545 7:28418529-28418551 AGATGGCTCTGCAGGGGATAAGG - Intronic
1026343377 7:69453236-69453258 AGCTGGGACTACAGGCAAAACGG - Intergenic
1026685309 7:72504629-72504651 ACCTGGAAATACAGGGAAAAAGG + Intergenic
1028765692 7:94556525-94556547 AAATGGATCCACAGGGTAACTGG - Exonic
1029363518 7:100102995-100103017 AGATGTATCTTCAGGGGAATTGG - Intronic
1030089099 7:105841540-105841562 ATATGGATCTGCTGGGCAAAGGG - Intronic
1031706883 7:124991941-124991963 AGAGGGATCCAGAGGGAACATGG + Intergenic
1032171438 7:129587843-129587865 AGAAGGATTCACAGAGAAAAGGG - Intergenic
1038672069 8:29590692-29590714 AGATGGTTTTGCAGAGAAAATGG + Intergenic
1039686206 8:39804284-39804306 AGAGGCAACTAAAGGGAAAATGG + Intronic
1039732571 8:40295492-40295514 AAATGGATCAACATGGGAAAAGG + Intergenic
1040958052 8:53000319-53000341 AGATGGATTCACAGGAGAAAAGG - Intergenic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1042829799 8:73014524-73014546 AAATGGAACTACAGAGACAAGGG - Intronic
1043762506 8:84085415-84085437 CAATGGATCTACAGAGAACATGG - Intergenic
1044843358 8:96356761-96356783 GCATGGGTTTACAGGGAAAAGGG + Intergenic
1045282730 8:100763349-100763371 AGATGGATGTCCAGGCAGAAAGG - Intergenic
1045297320 8:100883190-100883212 AGCTGGAACCACAGGGAGAAGGG + Intergenic
1046059833 8:109125206-109125228 AGATAGATCTATAGGCAAATTGG - Intergenic
1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG + Intergenic
1050316895 9:4411564-4411586 AGATGGGACCAAAGGGAAAATGG - Intergenic
1051966671 9:22836349-22836371 TGCTGGTTCTTCAGGGAAAAAGG + Intergenic
1055236140 9:74125731-74125753 AGATGGATCTTACAGGAAAAAGG - Intergenic
1056238166 9:84616715-84616737 AGATGATCCTACAGGCAAAATGG - Intergenic
1056407440 9:86288292-86288314 AAATGGATTTATACGGAAAAAGG + Exonic
1057466784 9:95321439-95321461 AGATGGAAATTCATGGAAAAAGG + Intergenic
1059960418 9:119559245-119559267 AGCTGGAGCCACAGGGAAAGGGG + Intergenic
1059993503 9:119887503-119887525 ATATGAATCTACAAGGAACAGGG - Intergenic
1060431248 9:123552839-123552861 ACATGGATTTACTGGGTAAACGG - Intronic
1062144488 9:134981433-134981455 TGATGGTTATACAGGGAGAAGGG + Intergenic
1062144593 9:134981970-134981992 GGATGGTTATACAGGGAGAAGGG + Intergenic
1062175249 9:135158444-135158466 AGATGAATGAACAGGGGAAACGG - Intergenic
1062528960 9:136991545-136991567 AGAGCGATCTCCAGGGAAGAAGG - Intergenic
1188679255 X:32981066-32981088 ACATGGAGGGACAGGGAAAACGG + Intronic
1190589877 X:51989012-51989034 AGAAAGATCTACAGGATAAAAGG - Intergenic
1190935880 X:54998773-54998795 AGATCGATCTTCAGTGTAAATGG + Intergenic
1191166934 X:57401483-57401505 AGCTGGATATAGAGGGACAACGG + Intronic
1192218750 X:69182304-69182326 ATATGCATCAACAGGGAAACTGG + Intergenic
1195252576 X:103063514-103063536 GGATGGATCTGTAGGGAAAATGG - Intronic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195278765 X:103310187-103310209 AGATGGATCTGCAGAGAAGATGG - Intronic
1195321657 X:103726142-103726164 ACATGGATCTACTGGGAAAGAGG - Intronic
1195980163 X:110568766-110568788 AGATGGGGTTGCAGGGAAAAGGG + Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196755187 X:119151234-119151256 AGATGGAGACAGAGGGAAAAGGG - Intergenic
1202039732 Y:20669066-20669088 AGAGGTGTCTACAGGGAAGAGGG - Intergenic