ID: 1195271063

View in Genome Browser
Species Human (GRCh38)
Location X:103231629-103231651
Sequence CCCCCACATAAGGAAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195271063_1195271071 27 Left 1195271063 X:103231629-103231651 CCCTTGCCTTCCTTATGTGGGGG No data
Right 1195271071 X:103231679-103231701 TAGAAACTCCTTTCCAGGCCAGG No data
1195271063_1195271070 22 Left 1195271063 X:103231629-103231651 CCCTTGCCTTCCTTATGTGGGGG No data
Right 1195271070 X:103231674-103231696 CTCATTAGAAACTCCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195271063 Original CRISPR CCCCCACATAAGGAAGGCAA GGG (reversed) Intergenic
No off target data available for this crispr