ID: 1195273057

View in Genome Browser
Species Human (GRCh38)
Location X:103252300-103252322
Sequence CTTCCTGAAGGCTCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195273057_1195273061 -7 Left 1195273057 X:103252300-103252322 CCTGCCCAGGAGCCTTCAGGAAG No data
Right 1195273061 X:103252316-103252338 CAGGAAGAGATCATCCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195273057 Original CRISPR CTTCCTGAAGGCTCCTGGGC AGG (reversed) Intergenic