ID: 1195273309

View in Genome Browser
Species Human (GRCh38)
Location X:103254343-103254365
Sequence GAGGGCCTGGGAAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195273309_1195273317 9 Left 1195273309 X:103254343-103254365 CCTTCAGACTTTCCCAGGCCCTC 0: 1
1: 0
2: 1
3: 27
4: 311
Right 1195273317 X:103254375-103254397 AGCCTCTCACCTGAGACGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 129
1195273309_1195273315 5 Left 1195273309 X:103254343-103254365 CCTTCAGACTTTCCCAGGCCCTC 0: 1
1: 0
2: 1
3: 27
4: 311
Right 1195273315 X:103254371-103254393 CTCCAGCCTCTCACCTGAGACGG 0: 1
1: 0
2: 1
3: 25
4: 245
1195273309_1195273320 21 Left 1195273309 X:103254343-103254365 CCTTCAGACTTTCCCAGGCCCTC 0: 1
1: 0
2: 1
3: 27
4: 311
Right 1195273320 X:103254387-103254409 GAGACGGCTGGTCCAGTCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195273309 Original CRISPR GAGGGCCTGGGAAAGTCTGA AGG (reversed) Intronic
900154333 1:1198034-1198056 GGGGGCCTGGGGAAGTCCCAGGG - Intergenic
900342139 1:2194402-2194424 GAGGGCCTGGGGAAGGTAGAGGG + Intronic
900793041 1:4692036-4692058 GAGGGCCTCGGCCAGTCTCAGGG - Intronic
900815675 1:4842018-4842040 GATGGCCTGGGACAGTCTGTTGG + Intergenic
902535870 1:17119064-17119086 GGGGGTCTGGGAGAGTCTCAGGG + Intronic
902864447 1:19269130-19269152 GAGGGCTTGGGAATTCCTGAAGG + Intergenic
903825949 1:26145929-26145951 GAGGGCCAGAGGAATTCTGAAGG - Intergenic
906181286 1:43821805-43821827 GAGGGCCTCGAAAAGTCTCAGGG + Intronic
907423339 1:54362402-54362424 AAGGGCCTGGCAAAGAGTGAAGG + Intronic
907809243 1:57852049-57852071 GAGGGCCAGGGAAGGTCAGAAGG - Intronic
907918498 1:58892154-58892176 GAAGCCCTTGGACAGTCTGATGG + Intergenic
908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG + Intronic
908909715 1:69059181-69059203 GAGAGGCTGGAAAAGTCTGCTGG - Intergenic
909073052 1:71019413-71019435 GAGGGCCTGGGAGAGTCACGTGG - Intronic
909711554 1:78655845-78655867 GAGGGCCTCAAAAAGTCAGAAGG - Intronic
910515127 1:88052565-88052587 GAGTGCCTGAGAAAGGCTGATGG + Intergenic
911791478 1:102021195-102021217 CAGGGCCTGGGACAGGGTGATGG - Intergenic
914459365 1:147868882-147868904 CAGGGGCTGGGATAGTCTGCAGG - Intergenic
916456096 1:164972377-164972399 GATGGTCTGGGGAAGTGTGAGGG + Intergenic
917243269 1:172972361-172972383 GTGGGCATGGGAAAGCCTGGAGG + Intergenic
917685064 1:177407479-177407501 GAGGCCCTGGGGAAATCTAACGG - Intergenic
918068467 1:181117870-181117892 GAGGGCCTGGGAAAGGCCAGTGG + Intergenic
919135277 1:193500138-193500160 GAGGGCCTGGGTAAGCCAGTGGG - Intergenic
919741076 1:200982071-200982093 GTGGGCCTGGCAGAGTCTGGGGG - Intronic
920932519 1:210401967-210401989 GTGGGCCTGAGATAGGCTGAGGG - Intronic
922460205 1:225810012-225810034 GAGGACCCGGGAAAGTCTCTAGG - Intergenic
923362079 1:233221683-233221705 GAGGGCCTGGGAAGCTCACATGG + Intronic
924444229 1:244113846-244113868 GAAGGCCTGGGAAAATCTTGTGG + Intergenic
1064456411 10:15491260-15491282 GAGGGCCAGAGAAAGAGTGATGG + Intergenic
1065137229 10:22683789-22683811 GAGAGACTGGGAAAGGCTAAGGG - Intronic
1065430103 10:25645209-25645231 GATGGGCTGGGTAAGTCAGAAGG + Intergenic
1065434403 10:25692368-25692390 GAGGCCCTGCGAGAGTCTGGGGG - Intergenic
1065510692 10:26475504-26475526 CAGGGCCTGGGATTGTGTGAAGG - Intronic
1065826215 10:29574283-29574305 GTGTGCCTGGGAGAGGCTGAGGG + Intronic
1065932147 10:30489519-30489541 GAGGGCAAGGGAAATTTTGAAGG - Intergenic
1065951157 10:30652335-30652357 GTGTGCCTGGGAGAGGCTGAGGG - Intergenic
1066323003 10:34324523-34324545 GAGGGGCTGTGAGAGTCAGAAGG + Intronic
1066746245 10:38605510-38605532 GAGGGCCCGGGAAAGGCACAAGG - Intergenic
1066987715 10:42482921-42482943 GAGGCACTGGGAAACTGTGATGG + Intergenic
1067021215 10:42799992-42800014 GAGGGCCTGGGAAACTCCAGAGG - Intronic
1070559426 10:77554728-77554750 GAAGGCCTTGGAAAGTTTGTGGG - Intronic
1070679315 10:78437643-78437665 GTAGCCCTGGGAAGGTCTGATGG - Intergenic
1071257215 10:83881608-83881630 GTGATCCTGGGAAAGCCTGAAGG - Intergenic
1071528464 10:86372076-86372098 GAGGGCCTGGGCCAGCCTGTGGG - Intergenic
1072705017 10:97674921-97674943 CAGGACCTGGGACAGTTTGAAGG - Exonic
1074285924 10:112098250-112098272 CAGGGTCTGGGAAGGACTGAGGG - Intergenic
1075764912 10:124885545-124885567 AGGGGCCTGGGAAGGTCAGAGGG - Intergenic
1076181943 10:128416211-128416233 GAGTGGATGGGAAATTCTGAGGG - Intergenic
1076577076 10:131476354-131476376 GAGGGCCTGGGTGGGCCTGATGG + Intergenic
1076811659 10:132889413-132889435 GAGGGCCTGGCAGAGTGTGAAGG - Intronic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1077466585 11:2736432-2736454 GTGGGCTTGGGAGAGCCTGAGGG + Intronic
1077470822 11:2759769-2759791 GAGGTCCTGGGAGGGGCTGAAGG + Intronic
1077500582 11:2908185-2908207 GAGGGGCTGGGAAAGACTGCAGG - Intronic
1078055431 11:8005344-8005366 GAGGGCATGGGAAACTGAGAAGG + Intergenic
1078565274 11:12409004-12409026 GAGGACCTGGGAGAGGCCGAGGG + Intronic
1078873765 11:15373449-15373471 GAGGGCCTTGGAAGGCCTGTAGG + Intergenic
1080552254 11:33382827-33382849 GAGGGCCAGGGGAAGTCCCAGGG - Intergenic
1081981644 11:47270353-47270375 GAGGCCCTGGGGGAGTGTGAAGG + Intronic
1082808664 11:57465407-57465429 GAGACCCTGGGAGAGACTGAGGG - Intronic
1083310415 11:61780910-61780932 GAGGGGCTGGGAGAGCTTGAGGG - Intronic
1083706400 11:64519276-64519298 AATGGCCTGGGAAAGAGTGATGG - Intergenic
1084171313 11:67402127-67402149 GAAGGGGTGGGAAAGTCTGTTGG - Intronic
1084591342 11:70092460-70092482 GAGGGCCAGGGAAGGTCTGGGGG + Intronic
1084644363 11:70446071-70446093 GAGGGTGTGGCACAGTCTGAGGG + Intergenic
1088785484 11:113177882-113177904 GAGGCCATGGGAAAATGTGACGG - Intronic
1089682356 11:120125795-120125817 GAGGGCCTGGGACAGTCACTAGG - Exonic
1090874494 11:130776673-130776695 GAGGGCTTGGGCAGGTCTGGAGG - Intergenic
1092233380 12:6790678-6790700 CAGGGGCTGGAAAGGTCTGAGGG - Intronic
1096882184 12:54682216-54682238 TAGATCCTGGGAAATTCTGAGGG + Intergenic
1099552731 12:84068606-84068628 GCAGAGCTGGGAAAGTCTGAGGG + Intergenic
1099924479 12:89000775-89000797 GAATGACTGGGAGAGTCTGAAGG - Intergenic
1100343887 12:93708315-93708337 TAGGGGCTGGGAAAGGCTGTAGG + Intronic
1100608470 12:96170990-96171012 CAGGGCATGGGATTGTCTGAAGG - Intergenic
1101780521 12:107831016-107831038 GAGGGCCTCTGAAGGTCAGAAGG + Intergenic
1102024631 12:109707312-109707334 GAGGACCTGGGAGAGCCTGCTGG + Intergenic
1102521104 12:113477795-113477817 GGGGGCCTGGGAGAGACAGAAGG + Intergenic
1102740232 12:115200485-115200507 AAGCACCTGGGAAAGTCTAAGGG + Intergenic
1104674948 12:130706136-130706158 CAGGGCCTGGAATAGTGTGAGGG - Intronic
1104770337 12:131357734-131357756 GAGGGGCTGGATAAGTCTGTGGG + Intergenic
1105032503 12:132893740-132893762 GAGGGCCTCTGAAAGTATTAGGG - Intronic
1106354189 13:28964001-28964023 AAGGGCCTGGGGAAGACTTATGG - Intronic
1108322270 13:49300781-49300803 GAGGTCCTGGGAAAGGATGGGGG - Intergenic
1110765705 13:79277793-79277815 GAGGGCCTCTGAAAGTATTAGGG - Intergenic
1111452203 13:88433976-88433998 GAGGGCAGGAGAAAGTCAGAGGG + Intergenic
1112004876 13:95245534-95245556 GAGGGGCTGGGAGAACCTGAGGG + Intronic
1114563246 14:23608643-23608665 GAGAGTCTGGGAAAGGCTGTTGG + Intergenic
1116170007 14:41388491-41388513 GAGGGCATGAAAAAGTCTGCAGG + Intergenic
1116666828 14:47787406-47787428 TAGGGCCTGCTGAAGTCTGAGGG + Intergenic
1117024318 14:51604789-51604811 GAGGGCCTGGAAGAGTATAAAGG - Intronic
1117767197 14:59095451-59095473 GGGGGCATGGGAATGGCTGAGGG - Intergenic
1118265422 14:64289897-64289919 GAATGCTTGGGAAAGTGTGATGG - Intronic
1118328350 14:64796697-64796719 GCAGGCCTGGGAAAGCCTGGAGG - Exonic
1118719701 14:68585411-68585433 GAGCCCCTGGGAAAGTCCGAGGG - Intronic
1119381905 14:74234569-74234591 GAGGGCCTGGGGGAGTGGGAGGG - Intergenic
1120729756 14:87989653-87989675 GAGGGCCTGGGTAAGTCAGTGGG - Intronic
1120751447 14:88202416-88202438 GAGAGGCTGGGAAAGTCAGTAGG - Intronic
1121389754 14:93563977-93563999 GAGGGCCTCTGAAAGTATTAGGG + Intronic
1123684601 15:22787682-22787704 GAGGGACTGAGAAAGTCTTGTGG + Intronic
1124242035 15:28036859-28036881 CAGGGCCTAAGAAAGACTGAGGG - Intronic
1124371879 15:29108611-29108633 GGGAGCCTGGGAAAGGCTGGAGG - Intronic
1127844429 15:62856990-62857012 GAGGGTCTGGGAGGGTGTGAGGG - Intergenic
1128987109 15:72230159-72230181 GAGGGCCTGGGAATGGCTCGGGG - Intronic
1129317060 15:74751357-74751379 GAGGGGCTGGGCAAGGCTGTGGG - Intronic
1129657090 15:77531549-77531571 GAGGGCCAAGGACAGTCTGGTGG - Intergenic
1130710560 15:86276931-86276953 AAGGTCCTGGGAAAGTTTAAAGG + Intronic
1130765415 15:86865741-86865763 GAGGGACTGGGAAAAAATGAAGG - Intronic
1130931666 15:88432898-88432920 GAGGGAGAGGGAGAGTCTGATGG + Intergenic
1130948209 15:88565304-88565326 GAGTATCTGGGAAAGACTGAAGG - Intergenic
1131519105 15:93099956-93099978 GAGGCCCAGGGGAAGTCTGGAGG + Intergenic
1131717094 15:95123706-95123728 GAGGGCCTTAGAAAATCTAATGG + Intergenic
1131728398 15:95252201-95252223 GAGAGCGTGGGAAACTCAGATGG - Intergenic
1132019287 15:98346426-98346448 GAAGGGCTGGGAGTGTCTGATGG - Intergenic
1132717205 16:1297405-1297427 GAGGTCCTGAGAATGTGTGAAGG - Intergenic
1133147177 16:3797084-3797106 GGGAGGTTGGGAAAGTCTGAAGG - Intronic
1133598159 16:7312885-7312907 GAGAGTCTGGGAGAGTCTGGCGG + Intronic
1134286687 16:12868034-12868056 GAGGGCATGAGAAAATTTGAGGG - Intergenic
1134328606 16:13229791-13229813 GGGTGGCTGAGAAAGTCTGAGGG + Intronic
1135104150 16:19632783-19632805 GAGGGCCTGGGACAGGCAGGTGG + Intronic
1135935844 16:26779295-26779317 GAAGGCCTGGGGAAGTCCCAAGG + Intergenic
1136736814 16:32474131-32474153 GAGGGCCCGGGAAAGGCACACGG + Intergenic
1137017186 16:35389420-35389442 GAGGGTCTGGGAAAGGATGGCGG - Intergenic
1137027315 16:35489982-35490004 GAGGGCCTGGGGAAGGATGGTGG + Intergenic
1137517147 16:49156301-49156323 GAGGGCCCAGGAAAATCTGGGGG + Intergenic
1137785510 16:51134602-51134624 CAGGGCCTGGGGACATCTGAGGG - Intergenic
1138097926 16:54227218-54227240 GAGGGCCAGGGAAAGAATGTTGG + Intergenic
1138225812 16:55293292-55293314 GAGGTCCTGGCAAAGGCTGTGGG + Intergenic
1141092749 16:81141365-81141387 GAGGGCCTGGGCATGGCTGTGGG + Intergenic
1141393752 16:83686392-83686414 TAGGCCCGTGGAAAGTCTGAAGG - Intronic
1141451584 16:84107127-84107149 GAGGGCACAGGAAAGTCAGAAGG + Intronic
1141535619 16:84677765-84677787 GAGGGCCTGGGTCAGGGTGAGGG + Intergenic
1141617389 16:85217725-85217747 GAGGGCTTAGGAAAGTCCGCTGG - Intergenic
1142498205 17:317568-317590 CAGGGCCTTGGCAAGGCTGAAGG + Intronic
1142616255 17:1137474-1137496 GAGAGGCTGGGAAAGGCTGGTGG + Intronic
1143240655 17:5440202-5440224 GAGAGCAAAGGAAAGTCTGAGGG + Intronic
1144105797 17:11984088-11984110 GAGGGTGTGGGTTAGTCTGATGG - Intronic
1144490441 17:15704323-15704345 GGGGGCCTGGGAGGGGCTGAGGG - Intronic
1144613820 17:16750502-16750524 GTTGACCTTGGAAAGTCTGATGG + Intronic
1144724097 17:17492853-17492875 GGGGACCTGGGAATGTGTGAAGG + Exonic
1144898892 17:18565164-18565186 GTTGACCTTGGAAAGTCTGATGG - Intergenic
1144943069 17:18954630-18954652 GTGGGCCTGGGAGAGTCTGGCGG + Intronic
1145133484 17:20380554-20380576 GTTGACCTTGGAAAGTCTGATGG + Intergenic
1146262633 17:31431912-31431934 GAGCGCCTGGGAAAGCCTCCCGG - Intronic
1146455996 17:33010146-33010168 GTGGACCTGGGGAAGTCTGGTGG - Intergenic
1147536262 17:41324828-41324850 GAGGGCTTGGGAATGTCGGGTGG + Intergenic
1147746404 17:42697439-42697461 AAGGCCCTGGGAATGGCTGAGGG + Intronic
1150280652 17:63928120-63928142 ATGAGGCTGGGAAAGTCTGAAGG + Intergenic
1153103654 18:1502953-1502975 GAGGTCATGGCAAAGTCTTAAGG - Intergenic
1156286950 18:35706110-35706132 GAGGGATTGGGAAAGACTGTTGG + Intronic
1157113401 18:44842149-44842171 GAGGGACTGAGAAAGACAGAGGG + Intronic
1158394425 18:57068678-57068700 GAGGGCCTCTGAAAGTATTAGGG + Intergenic
1158427779 18:57353974-57353996 GAGACCCAGGGAAAGTCTGGGGG - Intronic
1158892820 18:61889024-61889046 GAGGGCCAGGCACAGACTGAGGG - Intronic
1159476930 18:68933448-68933470 GAGGGCATGGAAATGTTTGATGG - Intronic
1163202682 19:15779946-15779968 GAGGCCCAGGGAAAGTCTCAGGG + Intergenic
1163418640 19:17202041-17202063 CAGGGTATGGGAAAGGCTGAAGG - Intronic
1165079667 19:33300130-33300152 GAGGGGCTGGGGAAAGCTGAGGG + Exonic
1166303581 19:41925531-41925553 AAGGGACCGGGAAACTCTGAGGG + Intronic
1166390501 19:42406614-42406636 GAAGCACTGGGAAAGTCTGTCGG + Intronic
1166672931 19:44722417-44722439 GAGGGTCAGGGACAGGCTGAGGG - Intergenic
1166685232 19:44792659-44792681 GAGGCCCTGGGAAAGACAGCCGG - Intronic
1168402233 19:56092209-56092231 GAGGGCCGGGGCCACTCTGATGG + Intronic
1168641731 19:58035231-58035253 GAGGGCCTGGGATGATGTGAAGG - Intronic
925169095 2:1740167-1740189 GAGGGCATGGGAAGTGCTGAGGG + Intronic
925835898 2:7946577-7946599 CATGGCATGGGAAAGTCTTAAGG + Intergenic
926149366 2:10416072-10416094 GAGGGCCTGGGCCATTGTGAAGG - Intronic
927047083 2:19290324-19290346 GAGGGCATGGGAAAGAGTTAAGG - Intergenic
927102416 2:19798421-19798443 GAGGCAGTGGGAAAGGCTGAAGG + Intergenic
927586202 2:24308023-24308045 GAGGGAGTGGGAAAGTTAGAAGG + Intronic
929034221 2:37675077-37675099 GAGTGCCTGGAACAGCCTGAAGG - Intronic
932497268 2:72152251-72152273 AAGGGCCTGGGAAATACAGAAGG + Intergenic
932749826 2:74364339-74364361 GAGCAGCTGGGAAAGTCTGGAGG + Intronic
934512858 2:94961300-94961322 GAAGGCCTGAGACAGCCTGAGGG - Intergenic
934562612 2:95320922-95320944 GAGGGCCTAGGGAAGGCTGGGGG - Intronic
935600516 2:104917479-104917501 AGGGGCCTGAGCAAGTCTGAAGG + Intergenic
935644527 2:105323228-105323250 GAGAGCCTGGAAAAGTCAGGTGG + Intronic
935728814 2:106047602-106047624 GAGGCCCTGGGAAAGTCTCTGGG - Intergenic
936010328 2:108921348-108921370 GGGGCCCTTGGCAAGTCTGACGG + Intronic
936064530 2:109320338-109320360 GTGGGCTTGGGAAAGGGTGAGGG - Intronic
938331964 2:130454363-130454385 GAGGCCTGGGGAAAGTCAGATGG - Intergenic
939196667 2:138981283-138981305 AAGGCCCTGGAAAAGACTGAAGG - Intergenic
940097074 2:149989137-149989159 GAGGGACTGGGAATGCCAGAGGG - Intergenic
941663661 2:168221710-168221732 GAGGAACTTGGAAAGTCTGCAGG - Intronic
941721726 2:168819874-168819896 GAGGGTCTGGCAAAGTGGGAAGG - Intronic
942347210 2:175015949-175015971 GAGGGTCTGGGAGAGTGGGAAGG - Intergenic
946192734 2:218016041-218016063 GAGGGCCAGGGAAAGGGGGAGGG + Intergenic
947181008 2:227411461-227411483 GAGGGCCTGCGAAACCCTCAAGG + Intergenic
947535173 2:230935512-230935534 GTGAGCCTGTGAAAGCCTGAGGG - Intronic
947537853 2:230952190-230952212 TAGGGACAGGGAAAGCCTGAGGG + Intronic
948541944 2:238697443-238697465 CAGGGCCTGGGATAGCCAGATGG - Intergenic
948784975 2:240347587-240347609 GAGGGCATGGGAAGCTCTGGAGG + Intergenic
948869261 2:240790103-240790125 CAGGGCCTGGGAAATGCTGGGGG - Intronic
1168915428 20:1481619-1481641 GAGGGTCTAGGAAAGACTTATGG + Intronic
1169028818 20:2392372-2392394 GAGGGCTTGGCCTAGTCTGAAGG - Intronic
1169484268 20:6013468-6013490 GAGGGCATGGGAACGGATGAAGG + Intronic
1169566413 20:6858064-6858086 GTGTGCCAGGGAAATTCTGAAGG + Intergenic
1170557066 20:17523370-17523392 GAGGGCCTCGGAGGGCCTGAGGG + Intronic
1172623102 20:36332332-36332354 GCGGGACAGGGAAAGTCTGCAGG - Intronic
1173945341 20:46945888-46945910 GTGGGCCTGGCAAGGTCTCACGG + Intronic
1175905519 20:62377701-62377723 GGGAGCCTGGGAGAGTCTTAGGG + Intergenic
1176075344 20:63245692-63245714 GAGGGTCTGGGAGAGGCTGGCGG - Intronic
1176236882 20:64057582-64057604 GAGGGCCCGGGAGCGTCTGGCGG + Intronic
1177344233 21:19848280-19848302 CAGTGCCTGCTAAAGTCTGAGGG - Intergenic
1178432057 21:32525765-32525787 CTTGGCCTGGGAAAGTCAGAGGG - Intergenic
1179801198 21:43812229-43812251 CAAGGCCTGGGAAAGGCTGCGGG - Intergenic
1180069830 21:45430750-45430772 GAGGGCCGGGGAAAGCCAGCCGG - Intronic
1180535736 22:16391787-16391809 GAGGGCCCGGGAAAGGCACACGG - Intergenic
1182667810 22:31972173-31972195 AAGGGCCTGGGAGATCCTGAGGG - Intergenic
1183058299 22:35320211-35320233 GAGGACCTGGGAAAGTGTTGTGG + Intronic
1183362943 22:37392134-37392156 GAGGGCCAAGGAAAGTCTAACGG - Intronic
1183490129 22:38111611-38111633 GAGGGGCTGGGCCAGTGTGAGGG + Exonic
1184910488 22:47529839-47529861 GAGGGCCCTGGAAGGTCGGAAGG - Intergenic
950438596 3:12994519-12994541 GGGGGTCTGGGGTAGTCTGAGGG - Intronic
951662179 3:25080103-25080125 TAGAGGCTGGCAAAGTCTGAGGG - Intergenic
952963098 3:38604903-38604925 GAGGGCCTGGAAAAGAGTGGAGG + Exonic
953669287 3:44948957-44948979 GAGGCAATGAGAAAGTCTGAAGG + Intronic
956361436 3:68452133-68452155 GAGGGCCTGAGAAGGCCTGAAGG + Intronic
956576518 3:70758251-70758273 GGGGACCTGGCAAAGTCTCAGGG - Intergenic
958523735 3:95225538-95225560 GAGGGCCTCTGTTAGTCTGATGG + Intergenic
959283521 3:104378632-104378654 GAGAGGCTGGAAAAGTATGAGGG + Intergenic
960905177 3:122593718-122593740 GTGGGGCTGGGAAAGGCTGAGGG - Intronic
961383076 3:126508504-126508526 GAGGGCCTGGGAAGGGCCTATGG + Intronic
961549898 3:127663467-127663489 GTGGGCCTGGGCAAGACTGAAGG + Intronic
962269925 3:133970040-133970062 GATGGCCTGGGGACATCTGAAGG - Intronic
962475118 3:135748494-135748516 GAGGACCTGGCAAAGTCTACCGG + Intergenic
963200842 3:142584430-142584452 AAGTGCCTGGGAAATGCTGAAGG - Intergenic
963345812 3:144095612-144095634 GAAATCCTGGTAAAGTCTGAGGG + Intergenic
964255056 3:154766561-154766583 GAAGGCCAGGGAGGGTCTGAAGG - Intergenic
964827436 3:160844290-160844312 GCGGGTCTCAGAAAGTCTGAAGG - Intronic
964940706 3:162155972-162155994 GAGGGCCTGTAAAAGTATTAGGG + Intergenic
966759823 3:183407973-183407995 AAGGGCCTGTGAAACCCTGAGGG + Intronic
967379429 3:188841035-188841057 CATGGCCAGGGACAGTCTGATGG - Intronic
967698696 3:192566508-192566530 GAGAGCCTGGGAAAATTTGCAGG + Intronic
968651125 4:1760720-1760742 CAGGGCCTGGGAACGGCTCAGGG + Intergenic
968916345 4:3498586-3498608 GAGGGCCTGGGGAGAGCTGAGGG - Intronic
972059187 4:34847093-34847115 TAGGGACTGGGAAAGCCAGAGGG - Intergenic
972396807 4:38664604-38664626 GCGGGCTTGGGAAAGTGTGGCGG + Intronic
972453574 4:39229948-39229970 GAGGGCCTGGGTAAAGATGAGGG - Intronic
974973015 4:68854143-68854165 CAGGACCGGGGAAAGCCTGAAGG - Intergenic
975584124 4:75933374-75933396 GAGGTCCTCAGTAAGTCTGAGGG - Intronic
979682715 4:123479310-123479332 GAGGGCCAGAGAAGGACTGAGGG - Intergenic
979722077 4:123912063-123912085 CAGGGCCTGGCAGTGTCTGAAGG + Intergenic
980709502 4:136545900-136545922 GAGGGCTTGTCAAAGGCTGAGGG + Intergenic
981626577 4:146763329-146763351 GAGAGAATGGGAAAGTCTGTGGG - Intronic
981673357 4:147312829-147312851 GAGGTCCTGGGAACGTCTCCAGG - Intergenic
981944542 4:150325904-150325926 AAGGGCAGGGGCAAGTCTGAAGG + Intronic
982453203 4:155576879-155576901 GAGGGGCAGGGGAAGTGTGAAGG + Intergenic
984265211 4:177490160-177490182 GAGGGCCTGGGTCTGTCTCATGG - Intergenic
985475264 5:75321-75343 GAGGCCCTGTGCAGGTCTGAAGG - Intergenic
985992947 5:3578291-3578313 GAAAGCCTGGCAAAGTATGAAGG - Intergenic
990144041 5:52738471-52738493 GAGAGCATGAGAAAGTCTGTAGG - Intergenic
992471602 5:77061764-77061786 GAGGGCCTGGGGAAGGATGGTGG + Exonic
992961085 5:81957156-81957178 GAGGGCCTCTGAAAGTATTAGGG - Intergenic
993075163 5:83220535-83220557 GAGGGCCTGGGGATGTGTGAAGG + Intronic
995614915 5:113951132-113951154 GAGGGCCTGGGATATTCAGCTGG + Intergenic
997955556 5:138275916-138275938 GAGGGCTTGGGAAAGGCACATGG - Intergenic
998230365 5:140357683-140357705 GTGGGCCAGGGCAAGGCTGAGGG + Intergenic
998601149 5:143586485-143586507 CAGGTCCTGGGAAAGACTTAAGG + Intergenic
999189114 5:149733080-149733102 GAGGGTCAGGGAAAGTTTGGGGG - Intronic
1000638318 5:163669464-163669486 GAGGGCTTGGGAAATTATTAAGG + Intergenic
1000857469 5:166417260-166417282 CAGGGCCTGCTGAAGTCTGAGGG - Intergenic
1001046031 5:168372456-168372478 ATGTGCCTGGCAAAGTCTGAAGG + Intronic
1001354023 5:171003064-171003086 GAGGGCCTCTGAAAGTATTAGGG + Intronic
1002138674 5:177125052-177125074 TAAGGCCTGGGAAACTCTGCAGG - Intergenic
1002761392 6:205190-205212 GAGGGCCCAGGAAAGTCTGGGGG - Intergenic
1004320221 6:14626150-14626172 GTGGGCCTGGGAAATTCGCAGGG - Intergenic
1005373035 6:25154757-25154779 GATGGGCTGGGAAAGTGTGAAGG - Intergenic
1005784357 6:29227719-29227741 GTGGGCATGGGATAGTCAGATGG - Intergenic
1006325052 6:33347319-33347341 GAGGGCCTGTAAAAGTATTAGGG - Intergenic
1006663960 6:35675883-35675905 GAGGGGGTGGGCAAGCCTGAGGG - Intronic
1007789769 6:44302302-44302324 GAGTGCTAGGGAGAGTCTGAAGG + Intronic
1008490018 6:52076982-52077004 GAGAGCCTGAGAAAGCCTGGCGG + Intronic
1010062863 6:71645408-71645430 GAGGGAGTGGGAAAGGGTGATGG + Intergenic
1011713868 6:90084111-90084133 GAGGGGGTGGGGAAGTATGAAGG + Intronic
1014690532 6:124558446-124558468 GAGAGACTTAGAAAGTCTGAAGG - Intronic
1015431199 6:133131873-133131895 GAGGGGCCGGGAAAGGCTGAAGG + Intergenic
1015506451 6:133993714-133993736 GAGGGACAGGAAAAGTCTGTTGG + Intronic
1015833121 6:137390600-137390622 GAGGGGCTGGGAAAGCAGGATGG - Intergenic
1015882192 6:137880766-137880788 GAGAGCCAGGGAAAGTTTGCAGG + Intronic
1017057805 6:150453584-150453606 GGAGGCCTGGGACAGGCTGAGGG + Intergenic
1018279240 6:162166924-162166946 GAGGAGTTGGGAAAGTCAGATGG - Intronic
1018842381 6:167526653-167526675 GAGGGCATGGTAGAGTCCGACGG + Intergenic
1019283287 7:211218-211240 GAAGGCATGGGAAGGTCCGAGGG - Intronic
1019652145 7:2165739-2165761 GAGGTACAGGGAAAGACTGACGG + Intronic
1020265448 7:6557211-6557233 GAGGGCTTGGGCCAGTCTGCAGG - Intergenic
1020960254 7:14793895-14793917 GAGGGCCTGAGTAAGACAGAAGG + Intronic
1022769088 7:33449545-33449567 GAGGGCTTGGGATGGCCTGAAGG + Intronic
1022814407 7:33900758-33900780 CAGGGCCAGGGAAAGAGTGAAGG + Intergenic
1022924794 7:35046209-35046231 GAGGCACTGGGAAATTGTGAAGG - Intergenic
1023175050 7:37427912-37427934 GGAGGCCTGGGAAACTCTGCTGG - Intronic
1023471423 7:40525533-40525555 GAGGGCCTGAGATAGTGTGAAGG + Intronic
1023506056 7:40900629-40900651 GAGGGGCTGAGGAACTCTGAAGG + Intergenic
1023632825 7:42180560-42180582 GATGGCCTGGAAAAGGCTGGAGG + Intronic
1028613562 7:92738857-92738879 GTGGGCCAGGAAAAGTTTGAAGG - Intronic
1029257910 7:99281745-99281767 GTGGGCCTGGGAAAGTCGGTGGG - Intergenic
1031069051 7:117142156-117142178 TAGGGCCAGGGAAAGACAGAGGG - Intronic
1033141811 7:138833997-138834019 GTGGGCCTGGGAAAGGCTGTAGG - Intronic
1034928736 7:155143863-155143885 GAGGGGCAGGGAAAGTGAGAAGG + Intergenic
1035284855 7:157799571-157799593 GAGGCCCTGGGCCAGTCGGAGGG - Intronic
1037292623 8:17367375-17367397 GAGGACATGGGAAAAGCTGAAGG + Intronic
1039936228 8:42048634-42048656 GAGGGCTTGGCAGAGTCTGGTGG - Exonic
1042344722 8:67715816-67715838 AAGTGCCTTAGAAAGTCTGAAGG - Intronic
1044589338 8:93898579-93898601 AGGGGCCCGGGAAAGTTTGAAGG + Intronic
1045035117 8:98170578-98170600 GAGGGTCTGGGAAAGCGTGAAGG - Intergenic
1047496695 8:125413860-125413882 GAGGGCATGGGAAAATCTTGGGG - Intergenic
1049005087 8:139849926-139849948 GAGGGCCTGGAATGGTCTGAGGG + Intronic
1049022994 8:139970581-139970603 GAGACCCTGGGAAAGGCGGAGGG - Intronic
1049478337 8:142807196-142807218 GAAGGCCTGGGAAAGGCTGAAGG - Intergenic
1049634724 8:143681474-143681496 GCAGGCCTGGGAAAGACTGTAGG - Intergenic
1049834189 8:144723205-144723227 GAGCGCGTGGGAAATTCTGCCGG - Exonic
1049838682 8:144755945-144755967 GGAGGCCTGGGAAGGTCAGAGGG - Intronic
1050153576 9:2642158-2642180 GAGGGCCTGGGAAAATCACTAGG + Intronic
1052728392 9:32257743-32257765 GAGGGCCTGGGGAACTATGAAGG - Intergenic
1053877575 9:42559673-42559695 GAGGGCCTGGCCAAGTGGGAGGG - Intergenic
1053895079 9:42734704-42734726 GAGGGCCTGGCCAAGTGGGAGGG + Intergenic
1054234119 9:62542021-62542043 GAGGGCCTGGCCAAGTGGGAGGG + Intergenic
1056606841 9:88093001-88093023 GAGGGGCTGGGAAATTTGGATGG - Intergenic
1056638050 9:88347693-88347715 GAGGGGCGGGGAAAGGCTGCAGG - Intergenic
1057431515 9:94999084-94999106 GAGGATCTGGGAAAATCTTATGG - Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059791569 9:117646364-117646386 GAGGGAGTGGGAAAGAATGAAGG - Intergenic
1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG + Intergenic
1060530090 9:124342921-124342943 GAGGGCCTGGCACAGGCAGAGGG - Intronic
1060901636 9:127262911-127262933 GAGAGCCTGGGAAAGGAAGAGGG + Intronic
1061862634 9:133475798-133475820 GAAGTCCTTGGAAAGTCTTAGGG + Intronic
1061967570 9:134025026-134025048 GAGGGGCTGGGAAAGGAGGAGGG - Intergenic
1062070795 9:134554031-134554053 GGGGGCCTGGGTGGGTCTGAGGG + Intergenic
1062353248 9:136149264-136149286 GGGGGCCTGGGAGAGGCTGAGGG - Intergenic
1062441627 9:136572320-136572342 GAGGAGGTGGGAAAGTCTGGCGG - Intergenic
1062634967 9:137485892-137485914 GAGGGCCTGGGACCCTCTGGGGG - Intronic
1185532357 X:832123-832145 GGGGGCTTGGGTCAGTCTGAGGG + Intergenic
1189233454 X:39470036-39470058 CAGGACCTGGGAAAGGCTGGTGG - Intergenic
1189304361 X:39975532-39975554 GAGGCCCTGGGAAAGGCAGCAGG + Intergenic
1192165534 X:68825382-68825404 GTGGGCCTGGGAAAGCCAGCAGG - Intergenic
1192233026 X:69278721-69278743 GAGGACCTGGGAAAGAGTGGGGG + Intergenic
1195273309 X:103254343-103254365 GAGGGCCTGGGAAAGTCTGAAGG - Intronic
1195296723 X:103485746-103485768 CAGAGCCTGGGAAACTGTGAAGG + Intergenic
1200065393 X:153502192-153502214 GAGGGGCTGGGGAAGGCCGAGGG - Intronic
1200111889 X:153744665-153744687 GAGGGCCCGGGAAAGGCACACGG - Exonic
1200223311 X:154402836-154402858 GAGGGCCTGGGAATGGGTGGTGG + Exonic