ID: 1195275394

View in Genome Browser
Species Human (GRCh38)
Location X:103276124-103276146
Sequence CCTGCAAGGCAGCGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195275394_1195275405 22 Left 1195275394 X:103276124-103276146 CCCGCCTCCCGCTGCCTTGCAGG 0: 1
1: 0
2: 7
3: 41
4: 375
Right 1195275405 X:103276169-103276191 TTCGTCGCTGTTCTCTTCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195275394 Original CRISPR CCTGCAAGGCAGCGGGAGGC GGG (reversed) Intronic
900218679 1:1495674-1495696 CCGGCAAGGCAGGGGTAGGAGGG - Exonic
900323332 1:2095636-2095658 CATGCCAGGCTGCGGGAGACAGG - Intronic
900549386 1:3246534-3246556 CCTGCAGGGCAGCGGCAGGGAGG - Intronic
900706639 1:4084901-4084923 CCAGCCATGCAGCGAGAGGCGGG - Intergenic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
901204493 1:7486181-7486203 CCTGCAAAGCAGTGGTATGCTGG + Intronic
902232468 1:15036515-15036537 GAAGCAAGGCAGAGGGAGGCAGG + Intronic
902287172 1:15414161-15414183 CCTGCAAGGCTGTGCTAGGCGGG - Intronic
902604517 1:17561430-17561452 ACTGCAAGGCTGCGGGGGGCAGG - Intronic
902613806 1:17612826-17612848 CATGCCAGGCAGCTGGGGGCCGG - Intronic
902810146 1:18883428-18883450 CCTGCAAGGCAGAGGGCCGGGGG + Exonic
903808535 1:26021973-26021995 CCTCCAAGGCAGGGGGACACCGG + Exonic
904050177 1:27634186-27634208 CCTCCAAGGCAACGAGAGGGCGG - Intronic
904078820 1:27859120-27859142 CGTGCAGGGCAGGGTGAGGCTGG - Intergenic
904581833 1:31549350-31549372 CCTGTAGGGGAGCGGGAGGGAGG + Intergenic
905973989 1:42162503-42162525 CCACCAAGGCAGCGGGTGGTGGG - Intergenic
906139384 1:43524707-43524729 CCTGTAAGGCAGCAGGAGAGAGG + Intergenic
906447689 1:45917512-45917534 CCTCCACGGCAGTGGGCGGCTGG - Intronic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
913186187 1:116372932-116372954 CATGCAGGGCAGCGGGAGGAGGG + Intronic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
916408317 1:164519623-164519645 CGTGCATGCCATCGGGAGGCAGG + Intergenic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
919428720 1:197466924-197466946 CGTGCAAGGCACAGGCAGGCAGG + Intronic
919870060 1:201813413-201813435 GCTGAATGGCAGCTGGAGGCAGG - Intronic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
922173688 1:223178427-223178449 CCTGTAAGCCAAGGGGAGGCTGG + Intergenic
922474777 1:225899335-225899357 CCTGGAGGGCAGCAGGGGGCAGG - Intronic
922749256 1:228063054-228063076 TCTGCAAGGCTGCTGCAGGCAGG - Intergenic
922985737 1:229864868-229864890 GCTCCAAGGCTGCAGGAGGCGGG + Intergenic
923400984 1:233614934-233614956 GCGGCAAGGCAGCGGGATGATGG + Intronic
923494491 1:234512673-234512695 CCTGCAGGGCAGGGGGCCGCTGG - Intergenic
923777870 1:236996133-236996155 CCAGCAAGGAAGCAGGAGGGAGG + Intergenic
1063382450 10:5594341-5594363 TCTGCAAGGCAGAGGGAGGGAGG - Intergenic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1064309816 10:14202200-14202222 GCTGCAAGACAGTGGCAGGCAGG + Intronic
1064312818 10:14226856-14226878 CTTGGAAGGCAGCGGGGAGCAGG - Intronic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1069201972 10:65630534-65630556 ACTGCAAGGGAGCCTGAGGCAGG + Intergenic
1070828188 10:79403430-79403452 CATGCACGGCCGGGGGAGGCAGG + Intronic
1071501601 10:86208103-86208125 GGAGCAAGGCAGTGGGAGGCAGG + Intronic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1074289875 10:112130422-112130444 CTTGCAAGGGAGGGGGTGGCAGG + Intergenic
1074461212 10:113638629-113638651 CCTGCAAGGCAGCAATTGGCTGG - Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075748552 10:124744484-124744506 CCTGCGAGGCCCCGGGACGCGGG + Intronic
1076198164 10:128535666-128535688 CCTGGAAGCCAGCAGGAGGCTGG - Intergenic
1076383073 10:130038376-130038398 CCTGCAAGGGAGCCACAGGCTGG - Intergenic
1076633629 10:131868528-131868550 CTTGAAGGGCAGCGGGAGGCAGG - Intergenic
1076783705 10:132738677-132738699 CCTGCCAGGCTGCTGGAGTCCGG + Intronic
1076919667 10:133445086-133445108 CCTCCAAGGCTGCCGGGGGCAGG + Intergenic
1077248417 11:1550102-1550124 CCTGGAAGTAAGCTGGAGGCTGG - Intergenic
1077249402 11:1554368-1554390 CCTCCAGTGCTGCGGGAGGCGGG - Exonic
1077320591 11:1939149-1939171 CCAGAAAGGCAGAGGCAGGCGGG + Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1082101876 11:48179525-48179547 CCTGCAAGAGGGCGGGATGCTGG + Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1084050889 11:66599198-66599220 CCTGGAAGGCACGGGGCGGCAGG + Exonic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1084534893 11:69750813-69750835 TCTGCCAGGCAGCTGGAGTCTGG - Intergenic
1084729500 11:71064400-71064422 CCGGCAAGGGGCCGGGAGGCAGG + Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087173738 11:95077253-95077275 TCTGCAAGGCAGCTGGAGTGAGG - Intergenic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088590703 11:111400120-111400142 CCAGCCAGTCAGTGGGAGGCTGG - Intronic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1088868932 11:113875357-113875379 CCTGCAGGGCTGCGGGTTGCGGG - Intronic
1089496610 11:118911313-118911335 CCTGCGGGGCTGCTGGAGGCTGG + Intronic
1090534271 11:127623734-127623756 GCTGCAAGGCAGCAACAGGCAGG - Intergenic
1090806952 11:130208783-130208805 TCTGCCAGGCAGAGGGAGACTGG - Intronic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1091640328 12:2231110-2231132 CCTGCCAGGCAGCTGGTGACTGG + Intronic
1091770323 12:3147231-3147253 GCTGCTGGGCAGCAGGAGGCAGG + Intronic
1091878758 12:3959638-3959660 TCTGCCAGACAGTGGGAGGCAGG + Intergenic
1092508076 12:9124773-9124795 CATGAATGGCAGCGGGAGGCAGG + Intergenic
1092926160 12:13274440-13274462 CCTGGAATGCACCGGGAGGATGG + Intergenic
1093512622 12:19947135-19947157 CCTGTCAGACAGCGGGAGGGTGG - Intergenic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1097751996 12:63365834-63365856 CCTGAAAGGCAGCAGGAAACAGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1101175239 12:102143200-102143222 ACTGCAAGGCAGCTGGGGGTGGG - Intronic
1101831737 12:108263179-108263201 CCTGCAGGGCAGCTGTAGGCTGG + Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102472219 12:113165770-113165792 TCTACAAGGCAGGGGGTGGCAGG - Intronic
1102524911 12:113505580-113505602 CCAAGAAGGCAGCAGGAGGCAGG + Intergenic
1103902187 12:124309074-124309096 CCTGCATGCCAGGGGGAGGCAGG + Intronic
1104927163 12:132319808-132319830 CCTAGAAGGACGCGGGAGGCTGG - Intronic
1106190800 13:27450726-27450748 CCTGCGGAGCAGCGGGAGCCAGG - Intergenic
1106577708 13:30991303-30991325 CGGGCAAGGCAGCGGAAGGAAGG + Intergenic
1108122850 13:47208451-47208473 TCTGCCAGGCAGCTGGAGTCTGG - Intergenic
1108524934 13:51278558-51278580 CCTGGGTGGCAGCAGGAGGCAGG - Intronic
1111985189 13:95058850-95058872 GCTGCCAGGCAGCAGGAGCCCGG + Intronic
1113876559 13:113598222-113598244 CCCCAAAGACAGCGGGAGGCAGG + Intronic
1113932695 13:113976674-113976696 CCTACAGGGCAGTGGGAGGTGGG - Intergenic
1114036748 14:18636498-18636520 ACTGCAGGGCAGCAGGAGGGGGG - Intergenic
1114063650 14:19041235-19041257 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1114098607 14:19358761-19358783 CCTGCCATGCAGCCAGAGGCTGG - Intergenic
1114121888 14:19678539-19678561 ACTGCAGGGCAGCAGGAGGGGGG + Intergenic
1114568188 14:23647585-23647607 CCTGGAAAGGAGCGGGAGCCTGG - Intergenic
1115271865 14:31561557-31561579 GCTGCAGGGCAGGGGGAAGCGGG + Intronic
1115642233 14:35342043-35342065 CCAGCAAGGCAGCTGCTGGCTGG - Intergenic
1116165829 14:41332951-41332973 CCATGAAGGCAGCGGGAGGGAGG - Intergenic
1117406725 14:55411533-55411555 CCAGCCAGGCAGCCGAAGGCTGG - Intronic
1119792995 14:77369911-77369933 CCTGTAAGGGAGGCGGAGGCGGG + Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121427918 14:93865938-93865960 CCTGGAAGGGAGATGGAGGCGGG - Intergenic
1121909651 14:97777273-97777295 CCTGCAAGGCTGTGGGAGCCGGG + Intergenic
1121995835 14:98602224-98602246 CCAGCAAGGCAGCAGAAGGCAGG - Intergenic
1122075259 14:99231427-99231449 GCAGCACGGCAGGGGGAGGCAGG + Exonic
1122075577 14:99232629-99232651 CCTGCAAGCCACCAGGAGCCAGG + Intronic
1123043992 14:105502669-105502691 CAGGCAGGGCAGCGAGAGGCCGG - Intergenic
1123492894 15:20796949-20796971 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1123549395 15:21366047-21366069 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1124042990 15:26122004-26122026 CCTGCAAGGCAGAGGCATGGTGG - Intergenic
1124408186 15:29410585-29410607 TCAGGAAGGCAGAGGGAGGCAGG - Intronic
1125584885 15:40813162-40813184 CCTGCAGGGCTGGGGCAGGCAGG + Intronic
1127606638 15:60592909-60592931 CCGGCAAGCCAGCGGGAGAGTGG - Intronic
1127708031 15:61566629-61566651 CCTGCAAGGCATGAGGAAGCAGG + Intergenic
1129708710 15:77809315-77809337 CCTCAAAGGCAGCGGGATCCGGG + Intronic
1129942826 15:79513000-79513022 CCTCCAAGGCAGTGTGAGGTGGG - Intergenic
1130031726 15:80320969-80320991 GCTGCAATGAAGCTGGAGGCTGG + Intergenic
1130353166 15:83108548-83108570 CCTGCAGTGGAGTGGGAGGCAGG - Intronic
1202957726 15_KI270727v1_random:93265-93287 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1132638023 16:962904-962926 CCTCCAAGGCAGTGGGAGCAGGG + Intronic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133304666 16:4801664-4801686 CCTCCAAGTCAGCGGGGGGAAGG + Intronic
1134174012 16:11991416-11991438 CATGCCAGGCAGGGGGAGACAGG + Intronic
1135407176 16:22206697-22206719 CCGGCAAGGCTGTGGGGGGCTGG + Intronic
1135845504 16:25914739-25914761 GCTGAAAGGCAGCGGAGGGCGGG + Intronic
1135937858 16:26796326-26796348 CCAGCAGGGCAGCAGGAGGAAGG + Intergenic
1136235435 16:28910914-28910936 CCTGCAAGGGACCGTGAGCCAGG - Exonic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139852813 16:69961171-69961193 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1139853052 16:69962146-69962168 CCAGCCAGGCAGCGGGATGGGGG - Intronic
1139881784 16:70184079-70184101 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1139882023 16:70185054-70185076 CCAGCCAGGCAGCGGGATGGGGG - Intronic
1140370486 16:74410451-74410473 CCAGCCAGGCAGCGGGATGGGGG + Intronic
1140370725 16:74411427-74411449 CCTGCAAGGCAACCAGTGGCTGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141828098 16:86494895-86494917 CCTGTGAGCCAGCGCGAGGCCGG + Intergenic
1142105230 16:88299063-88299085 CCTGCAAGCCAATGGGGGGCAGG + Intergenic
1142112852 16:88341397-88341419 CGTGCTGGGCAGCGTGAGGCAGG + Intergenic
1142163316 16:88570578-88570600 CCGGGAGGGCGGCGGGAGGCCGG + Intronic
1142417670 16:89951727-89951749 CATTCCAGGCAGCAGGAGGCAGG + Intronic
1142752263 17:1996052-1996074 CCTGCCAGGCAGCCTGAGCCAGG - Intronic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1143120096 17:4600983-4601005 CCTGTAAGGGAGCTGGAGGATGG - Intronic
1143382844 17:6507201-6507223 GCTTCAAGGCGGCAGGAGGCAGG + Intronic
1144735723 17:17554245-17554267 GCCACAAGGCAGTGGGAGGCTGG + Intronic
1145209365 17:21002019-21002041 GCTGCCAGGCAGCGGTAGCCAGG + Exonic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1147323488 17:39659439-39659461 CCTGGACGGAAGCAGGAGGCAGG - Exonic
1147535924 17:41323406-41323428 CCTGCAACTCAGAGGGAGCCAGG - Intergenic
1147884939 17:43678046-43678068 CCGCCAAGGCAGTGGGAGACCGG - Intergenic
1148438962 17:47701989-47702011 CCTGAAAGGAAGCGTGTGGCTGG - Intronic
1148645878 17:49219518-49219540 CCTGCGAGGGAGCGGGAGGTAGG - Exonic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150681687 17:67289800-67289822 CCTGGAAGGGAGCAGCAGGCTGG + Intergenic
1151404368 17:73877198-73877220 GCTGCAAGGGAGAGGAAGGCAGG - Intergenic
1151646208 17:75433763-75433785 CCTGGAAGGCAGCAGCAAGCAGG + Intergenic
1152262278 17:79273608-79273630 CCTGGGGGGCAGCGTGAGGCTGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152448853 17:80363743-80363765 CATGCAAGGCAGCGGGAGCCTGG + Exonic
1154324055 18:13377016-13377038 CCTGCAAGGCCAGGCGAGGCAGG - Intronic
1154450435 18:14471482-14471504 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1156271892 18:35542661-35542683 CCTGCAAGGTAAGGGGAGACAGG + Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157386583 18:47263478-47263500 CCTGCAGGGCAGCGCGGGCCGGG + Intergenic
1158393271 18:57060772-57060794 CCTGGAATGCAGCATGAGGCTGG + Intergenic
1158941810 18:62411728-62411750 CCTGCAAGTAAGCGAGAAGCAGG - Intergenic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1161200093 19:3009750-3009772 CTCCCAAGGCAGTGGGAGGCGGG - Intronic
1161579744 19:5074267-5074289 TCTGGAAGGCAGCTGGGGGCAGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1163287148 19:16355899-16355921 CCTGCAAGCTGGAGGGAGGCAGG + Intronic
1163424934 19:17236057-17236079 GCTGCACCGCTGCGGGAGGCGGG + Exonic
1163710966 19:18846522-18846544 CGGCCAAGGCAGCGGGAGGCAGG - Intronic
1163723716 19:18910784-18910806 CCTGCACAGCAGTGGGGGGCTGG - Intronic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1163993612 19:21022301-21022323 ACTGCAAGCCAGAGTGAGGCTGG - Intronic
1163999455 19:21083495-21083517 ACTGCAAGCCAGAGTGAGGCTGG - Intronic
1164005329 19:21143053-21143075 ACTGCAAGCCAGAGGGAGGCTGG - Intronic
1164030385 19:21398127-21398149 ACTGCAAGCCAGAGTGAGGCCGG - Intronic
1164070753 19:21766248-21766270 ACTGCAAGCCAGAGTGAGGCTGG + Intronic
1164316015 19:24088505-24088527 CCTGCAAGCCAGAGTTAGGCTGG - Intronic
1164710642 19:30354798-30354820 CCTGAAAGTCAGCGAGGGGCAGG - Intronic
1164794555 19:31015445-31015467 CCTGCTAGGCATCTGCAGGCAGG + Intergenic
1164823013 19:31264594-31264616 CCTGCATGACAGCAGGTGGCTGG - Intergenic
1165772634 19:38387940-38387962 CCTGCGAGCCCGCGGGAGCCCGG + Intronic
1166293631 19:41878532-41878554 CCGGGAAGGCTGCGGGAGGAGGG + Intronic
1166744396 19:45133742-45133764 CCTTTAAGGCAGCAGGAAGCAGG - Intronic
1167235054 19:48309200-48309222 CATGAATGGCAGCAGGAGGCAGG + Intronic
1167590738 19:50403031-50403053 CCTGCGAGGCAGGAGGATGCAGG - Exonic
1167592118 19:50409682-50409704 CCTGGAAGGCAACTGGGGGCAGG + Intronic
1167635931 19:50655769-50655791 CCTGCAAGGCAGGAGGAAGCAGG - Intronic
1168031432 19:53682991-53683013 CCTGGAGGGAAGCAGGAGGCTGG + Intergenic
1168038286 19:53737896-53737918 CCTGGATGGAAGCAGGAGGCTGG + Intergenic
1168041953 19:53765852-53765874 CCTGGATGGAAGCAGGAGGCTGG + Intergenic
1168056703 19:53868511-53868533 CCTGAAAGGCCGAGGGAGGGGGG + Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925410380 2:3636472-3636494 CCTGCAAGACAGTGGGTGGTGGG - Intronic
925733499 2:6940980-6941002 CCTGCAGAGCTGGGGGAGGCTGG - Exonic
926006559 2:9377570-9377592 CCTGCCTGGCAGCTGAAGGCTGG + Intronic
926320679 2:11746689-11746711 CCTGCTCCACAGCGGGAGGCTGG - Intronic
927493777 2:23538505-23538527 CCTGTATGGCAGAGAGAGGCTGG - Intronic
927680363 2:25135178-25135200 CCTGGAGGGAAGCGGGAGCCAGG - Intronic
928108210 2:28486477-28486499 TCTGCAGGGCAGTGGGAAGCTGG + Intronic
928407868 2:31028614-31028636 CCTTCGAGGCAGCAGGAGGCGGG + Intronic
928679132 2:33680872-33680894 CCAGGAAGGCAGTGGGAGGCAGG + Intergenic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
929553500 2:42909041-42909063 CCTGCAAGGCTGAGGGAGTTGGG + Intergenic
929701392 2:44166290-44166312 CCTGCAAGGCCGGGGGAGCCGGG - Intergenic
929732656 2:44512138-44512160 CCTGCAAGGTAGTGGCAGCCTGG - Intronic
932048755 2:68378385-68378407 CCTGCAAGTCTGAGGCAGGCCGG + Intronic
932494618 2:72140230-72140252 TGTGCCAGGCAGCGGGAGGGTGG - Intronic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
933050233 2:77593228-77593250 ACTGCAAGGAGGCGCGAGGCTGG + Intronic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933810191 2:86028244-86028266 GCTGGAAGGAAGCGGGAAGCAGG - Intronic
935708931 2:105880535-105880557 GCGGCAAGGCAGCTGGGGGCAGG + Intronic
936284630 2:111172827-111172849 CCTGCAAGGCAGCAGGTGCGTGG - Intergenic
937278127 2:120699376-120699398 CCTGCAAGGGGTCTGGAGGCAGG + Intergenic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938406971 2:131038227-131038249 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938406993 2:131038318-131038340 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938407004 2:131038349-131038371 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938407041 2:131038500-131038522 ACTGCAAGGCTGCAGGAGGGAGG - Intronic
938407050 2:131038531-131038553 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938480978 2:131661258-131661280 CCTGCCATGCAGCCCGAGGCTGG + Intergenic
938625972 2:133110080-133110102 CCTGCAAGGCTGTGGCAGGGAGG - Intronic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
942190572 2:173465082-173465104 CCTGCAAGGCAGTGCGGAGCTGG + Intergenic
943023512 2:182602048-182602070 CATGAATGGCAGCAGGAGGCAGG - Intergenic
944962481 2:204890718-204890740 CCTGCTAGCCACAGGGAGGCAGG + Intronic
946025921 2:216671575-216671597 CTTACAAGGCAGTGGGAGGAGGG + Intergenic
947820913 2:233068873-233068895 CCTGGAAGCCAGCAGGAGGAAGG + Intronic
948578497 2:238969143-238969165 CCTGGCAGGCTGCGGGCGGCTGG - Intergenic
948702128 2:239767061-239767083 CCTGCAGGGCTGGGGGAGGTTGG + Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1170595022 20:17798744-17798766 CCTCCAGGGCAGCTGGAGGCAGG - Intergenic
1171308325 20:24124996-24125018 CCTGCAAGGCAGAGAGAAGTTGG + Intergenic
1172876746 20:38169113-38169135 CCTGCAGGGCACGGGGAGACAGG - Intergenic
1173174537 20:40754534-40754556 GCTGCAAGGGAGTGGGAGGAGGG - Intergenic
1173203257 20:40969634-40969656 GCTGCAGGGCAGCGGAAGGCAGG + Intergenic
1173934551 20:46849947-46849969 TCTGGAAGGCGGCAGGAGGCAGG + Intergenic
1174912191 20:54619295-54619317 CCAGCAAGGCAGCTGGCAGCTGG - Intronic
1175084534 20:56447450-56447472 CCTGCAGGGCTGCAAGAGGCAGG + Intronic
1175612805 20:60365439-60365461 CCTGCAGGGCAGGGAGGGGCTGG - Intergenic
1175833752 20:61980835-61980857 CCTGCAAGGCCGCGGTGGGGCGG + Intronic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180170301 21:46054982-46055004 TGTGCAGGGCAGAGGGAGGCAGG - Intergenic
1180460872 22:15563546-15563568 ACTGCAGGGCAGCAGGAGGGGGG - Intergenic
1180482145 22:15763869-15763891 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1180802119 22:18636833-18636855 CCAGCAGGGCACGGGGAGGCTGG - Intergenic
1180853358 22:19032385-19032407 CCAGCAGGGCACAGGGAGGCTGG - Intergenic
1180939106 22:19645253-19645275 CCAGCCAGGGAGCGAGAGGCAGG - Intergenic
1181031621 22:20150904-20150926 CCTCCATGGCTGCTGGAGGCTGG + Intergenic
1181219603 22:21358426-21358448 CCAGCAGGGCACGGGGAGGCTGG + Intergenic
1182079417 22:27518554-27518576 CCTGGAAGGCTGCTGGAGGCTGG - Intergenic
1182519100 22:30875325-30875347 GCCACAAGGCAGAGGGAGGCTGG - Intronic
1182522564 22:30892595-30892617 CCAGCAAGGCAGGGGAGGGCCGG + Intronic
1183310927 22:37109184-37109206 CCTGCGAGGCAGGGGTAGGGTGG + Intronic
1183412155 22:37661155-37661177 CCTGCAAGGCAGGTGTGGGCAGG - Intronic
1183439112 22:37813212-37813234 GCTGGAAGGCTGGGGGAGGCGGG + Intronic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
1183689049 22:39377786-39377808 CATGCAGGGCAGTGGAAGGCTGG + Intronic
1183738902 22:39659325-39659347 AATGCAGGGCAGGGGGAGGCGGG - Intronic
1183978466 22:41526502-41526524 CCTGCAAGGCAGGTGCAGGGAGG + Exonic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
1184191787 22:42899774-42899796 CCAGCAGTGCAGCGGGAGGAAGG + Intronic
1184665662 22:45987624-45987646 CATGAATGGCAGCAGGAGGCAGG + Intergenic
1184714609 22:46273772-46273794 CCAGCCAGGCAGCAGCAGGCTGG - Intronic
1184937726 22:47737221-47737243 CTCGCAAGGCTGCGGGAGGGAGG - Intergenic
1185081240 22:48710512-48710534 CCTGGACGGATGCGGGAGGCTGG - Intronic
1185155702 22:49192236-49192258 CAGGCAAGGCAGCTGCAGGCAGG - Intergenic
950103709 3:10375171-10375193 CCTGCAAGGCGGCGTGTGGCTGG + Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
951476570 3:23112760-23112782 CCTGCAGTGCAGCCTGAGGCAGG + Intergenic
951519484 3:23598057-23598079 GCTGCAAGGTAGCTGGAGCCTGG + Intergenic
952967255 3:38628992-38629014 CCAGAAAGGCAGGGGTAGGCTGG + Intronic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
953982820 3:47421121-47421143 CCGGCAGGGCAGCAGCAGGCAGG + Intronic
954212265 3:49104555-49104577 GCTGCAACGCAGCGCGGGGCGGG - Intronic
954406411 3:50347748-50347770 GCTGCAAGACAGGTGGAGGCAGG - Exonic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955943976 3:64173564-64173586 CTTGCAAGGCAGTATGAGGCCGG + Intronic
956567842 3:70659536-70659558 CCTTCAAAGCACTGGGAGGCTGG + Intergenic
958533781 3:95368460-95368482 CCTGCAAGGCAGCCTGATCCCGG - Intergenic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
959222588 3:103540791-103540813 CCTTCAATGCTGCGGGAGGTGGG - Intergenic
959742970 3:109742333-109742355 GCAGCAAGGCACAGGGAGGCTGG - Intergenic
961550598 3:127668625-127668647 CCAGGAGGGCAGTGGGAGGCGGG + Intronic
961563104 3:127745017-127745039 CCTGGAAGGCAGCAGAAAGCAGG + Intronic
961792192 3:129384254-129384276 CCTGCAAGGCAGCCAGAGGCTGG + Intergenic
967852682 3:194093950-194093972 CCTGCGTGGCAGTGTGAGGCAGG + Intergenic
968001492 3:195209717-195209739 CCCGCCAGGCAAGGGGAGGCCGG + Intronic
968540989 4:1168329-1168351 CGTGCACGGCAGAGTGAGGCGGG - Intronic
968741409 4:2333325-2333347 CCTGGGAGGCAAGGGGAGGCGGG - Intronic
968768308 4:2486625-2486647 CCTGCAGGGATGCAGGAGGCTGG + Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968962859 4:3753937-3753959 CCTCCAAGACCGCGGCAGGCGGG + Intergenic
969184673 4:5466237-5466259 GCTGCCAGGGGGCGGGAGGCGGG + Intronic
969485586 4:7470765-7470787 CCCACAAGGCAGTGGGAGGCAGG + Intronic
978776260 4:112509767-112509789 CCTGCAAGGTGGCGTGAGTCGGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981067259 4:140498227-140498249 CTGGCCAGGCTGCGGGAGGCCGG + Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
984243800 4:177250232-177250254 CCTGTTAGGCGGCGGGAGGAAGG - Intergenic
984887368 4:184461978-184462000 CCTAGAAGGCAGACGGAGGCTGG - Intronic
985091399 4:186366184-186366206 CCTGCAGGCCTGCGGGAGGAAGG - Intergenic
989418245 5:41205646-41205668 ACTGCAAGGCACAGGGAGGCTGG + Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992907060 5:81357019-81357041 AATGCAAGGTAGAGGGAGGCGGG - Intronic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
1001413122 5:171524690-171524712 CCTGCCATGCAACGGGAGGAGGG + Intergenic
1001835176 5:174825453-174825475 CCTGCAATCCAGCGGCAGTCAGG - Intergenic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1002759582 6:191369-191391 CCCCCAAGGAAGGGGGAGGCAGG - Intergenic
1002815962 6:680584-680606 CCTGCAGGGCAGCTGCTGGCTGG + Intronic
1002929473 6:1623639-1623661 CCTGCAAGGCTAAGGGGGGCGGG - Intergenic
1004590566 6:17047384-17047406 CCAGCAAGGCACCCGGAGGATGG + Intergenic
1005811566 6:29519881-29519903 CCTGCAAGGCAGAGGGAGAGAGG - Intergenic
1005890168 6:30130935-30130957 CCTGCAGGGCTGCAGAAGGCAGG - Intergenic
1006113565 6:31763263-31763285 CCTGGAGGGCAAGGGGAGGCAGG - Intronic
1007269364 6:40624436-40624458 CCTGCCAGACAGGGTGAGGCAGG + Intergenic
1007775540 6:44222662-44222684 CCTCCAAGGGAGGGGGAGGGAGG - Intronic
1007830062 6:44631081-44631103 CCTGCAAGGCTGCCGGAGAGAGG - Intergenic
1010352336 6:74888990-74889012 ACTGCAAGGCGGCAGCAGGCTGG - Intergenic
1010353510 6:74904169-74904191 ACTGCAAGGCGGCAGCAGGCTGG + Intergenic
1012209280 6:96500028-96500050 CCTGCAAGGCAGCAGCCTGCTGG - Intergenic
1012889906 6:104885888-104885910 CATGAACGGCAGCAGGAGGCAGG + Intergenic
1013279856 6:108625898-108625920 CTTGCAAGGAGGCAGGAGGCAGG - Intronic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1014155920 6:118109709-118109731 CCTGCCAGACAGTGAGAGGCTGG - Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015124010 6:129732162-129732184 CCAGCAAGGCTGCTGGAGGTTGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019013407 6:168861240-168861262 CCTGAGAGGCAGCGGCAGCCCGG + Intergenic
1019174443 6:170153053-170153075 CCTGCAGGGCAGCCGCAGCCTGG - Intergenic
1019352568 7:561874-561896 CCTGCATGCCAGAGTGAGGCAGG + Intronic
1019454764 7:1121101-1121123 CCGCGTAGGCAGCGGGAGGCCGG - Intronic
1020811480 7:12854767-12854789 GATGCAAGGCAGTGGGAGGTGGG + Intergenic
1022339489 7:29455059-29455081 CCTTCAGGGCAGGGGTAGGCAGG + Intronic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023568944 7:41552868-41552890 TCTGCAAGGCAGCAGCTGGCAGG - Intergenic
1023880045 7:44313154-44313176 CCAGCTAGGCAGCGGGAGGTGGG - Intronic
1024476105 7:49813218-49813240 CCTGCAGGAGAGCAGGAGGCAGG - Intronic
1026735847 7:72948159-72948181 ACTGGACGGCAGCGGGAGGCTGG + Intronic
1026786190 7:73303090-73303112 ACTGGACGGCAGCGGGAGGCTGG + Intronic
1026970145 7:74462836-74462858 CCCGGAGGGCAGCGGCAGGCAGG - Intronic
1027107887 7:75416904-75416926 ACTGGACGGCAGCGGGAGGCTGG - Exonic
1029212015 7:98916882-98916904 CCTGCACGGCACAGGAAGGCAGG - Intronic
1029404705 7:100367512-100367534 GCCGCAAGGCAGAAGGAGGCTGG + Exonic
1029444034 7:100603107-100603129 ACTGCCAGGCAGAGTGAGGCGGG + Intronic
1030142614 7:106320568-106320590 ACTGCAAGGTGGCGCGAGGCTGG + Intergenic
1031799254 7:126222519-126222541 CTTACATGGCAGCAGGAGGCAGG + Intergenic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1032469516 7:132168237-132168259 CCTGCAAGGCACGGTGAGCCAGG + Intronic
1034551068 7:151820966-151820988 CCAGCAATGCAGCATGAGGCAGG - Intronic
1034991266 7:155549415-155549437 CCTGCATGGCCACGGGGGGCGGG - Intergenic
1035207084 7:157300704-157300726 TCTGCAGGGGAGCGGGAGGCCGG + Intergenic
1035292869 7:157850723-157850745 CCTGCAGGGCAGGTGCAGGCTGG + Intronic
1035455063 7:159002832-159002854 CCTGCAGGGCCACGGGATGCTGG + Intergenic
1035654211 8:1293296-1293318 CCAGCCAGGCAGCAGCAGGCTGG + Intergenic
1037818641 8:22125072-22125094 TCTGCAAGGCACTGGGAGGTGGG - Intronic
1038902277 8:31857207-31857229 ACTGCAAGGCGGCAGCAGGCTGG - Intronic
1045588120 8:103562553-103562575 CCATGAAGGCAGCGGGAGGGAGG - Intronic
1047748991 8:127866049-127866071 CTGGCCAGGCAGCCGGAGGCAGG - Intergenic
1047816665 8:128471867-128471889 CACCCAAGGCAGCGGGAAGCAGG + Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049407557 8:142458356-142458378 CCAGGATGGCGGCGGGAGGCGGG + Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049423459 8:142526898-142526920 CCTGCAAGCCAGGCAGAGGCGGG - Intronic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053230220 9:36401305-36401327 TCCGCAGGGCAGCGGGGGGCGGG - Intronic
1056760598 9:89411960-89411982 GCTGCAAGGCAGCCTGAGACGGG - Intronic
1057196193 9:93116651-93116673 CCAGCCAGGCTGCGGGAGGGTGG - Intergenic
1057792089 9:98131059-98131081 CCTGCAGGGGAAGGGGAGGCAGG + Exonic
1059154880 9:111980826-111980848 CTTGCCAGGCAGCCTGAGGCTGG + Intergenic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059402272 9:114077792-114077814 GCTGCAGGGCAGTGGCAGGCAGG + Intronic
1060770754 9:126330033-126330055 CCTCCCAGGCAGCCGGAGACAGG - Intronic
1061227024 9:129286296-129286318 CCTGTCAGGGACCGGGAGGCAGG + Intergenic
1061274576 9:129562068-129562090 CCTGCAGGCCTGCGGGAAGCAGG + Intergenic
1061326831 9:129869263-129869285 CCGGCCAGGCAGGTGGAGGCTGG + Intronic
1061397547 9:130351633-130351655 CCTCTAAGGCAGCGGGCAGCTGG - Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061723744 9:132570027-132570049 CCTAAAAGGCAGCTAGAGGCTGG - Intronic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062192195 9:135253767-135253789 ACGGCACGGCAGCAGGAGGCTGG - Intergenic
1062193683 9:135260777-135260799 GGGGCAAGGCAGGGGGAGGCGGG + Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062427025 9:136510805-136510827 CCTGCGGGGCAGGAGGAGGCCGG + Exonic
1062542963 9:137049625-137049647 TCTGGAGGGCAGGGGGAGGCCGG - Intronic
1062568764 9:137174896-137174918 CCTGCAGGGCAGCGCCTGGCGGG + Exonic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1186510735 X:10128078-10128100 CCATCAAGGACGCGGGAGGCTGG + Exonic
1186743068 X:12538254-12538276 ACTGAAAGGCAGCAGCAGGCTGG + Intronic
1187390471 X:18883505-18883527 TCTCCCAGGTAGCGGGAGGCTGG + Intergenic
1191038431 X:56052862-56052884 ACTGCAAGGCCGCAGGAGGCTGG - Intergenic
1191675201 X:63785519-63785541 ACTCCAGCGCAGCGGGAGGCAGG - Intronic
1195159295 X:102155592-102155614 CCTGCAGGTCCGCGGGAGGGAGG - Exonic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1196881689 X:120204677-120204699 GCTTGAAGGCACCGGGAGGCTGG - Intergenic
1200252057 X:154559046-154559068 CTCGCAGGGCAGCGGGAGGCTGG - Intronic
1200265711 X:154645370-154645392 CTCGCAGGGCAGCGGGAGGCTGG + Intergenic
1202113224 Y:21446243-21446265 CCTGCCAGGCAGTGTGGGGCTGG - Intergenic