ID: 1195279189

View in Genome Browser
Species Human (GRCh38)
Location X:103313526-103313548
Sequence CTGAATTTACAGATGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195279189_1195279191 4 Left 1195279189 X:103313526-103313548 CCCAAATTCATCTGTAAATTCAG No data
Right 1195279191 X:103313553-103313575 ATCCATATGAAAATCTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195279189 Original CRISPR CTGAATTTACAGATGAATTT GGG (reversed) Intergenic
No off target data available for this crispr