ID: 1195280093

View in Genome Browser
Species Human (GRCh38)
Location X:103324015-103324037
Sequence CTGTGTCAGTTTTGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195280093_1195280096 30 Left 1195280093 X:103324015-103324037 CCATCCACTCAAAACTGACACAG No data
Right 1195280096 X:103324068-103324090 CGCCTTTCATTGAGTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195280093 Original CRISPR CTGTGTCAGTTTTGAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr