ID: 1195281056

View in Genome Browser
Species Human (GRCh38)
Location X:103332870-103332892
Sequence CACATCTGACTCCTATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195281056_1195281058 -9 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281058 X:103332884-103332906 TCAGATGTGATGAGTCCACTTGG No data
1195281056_1195281060 -2 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281060 X:103332891-103332913 TGATGAGTCCACTTGGGATTTGG No data
1195281056_1195281062 5 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281062 X:103332898-103332920 TCCACTTGGGATTTGGACTAGGG No data
1195281056_1195281064 24 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281064 X:103332917-103332939 AGGGTATAAATTTAAGTCAAAGG No data
1195281056_1195281059 -8 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281059 X:103332885-103332907 CAGATGTGATGAGTCCACTTGGG No data
1195281056_1195281061 4 Left 1195281056 X:103332870-103332892 CCTCTCCATAGGAGTCAGATGTG No data
Right 1195281061 X:103332897-103332919 GTCCACTTGGGATTTGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195281056 Original CRISPR CACATCTGACTCCTATGGAG AGG (reversed) Intergenic
No off target data available for this crispr