ID: 1195282447

View in Genome Browser
Species Human (GRCh38)
Location X:103349002-103349024
Sequence CAGGGTGAAGGAAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195282447_1195282459 18 Left 1195282447 X:103349002-103349024 CCCTCCACTCTTCCTTCACCCTG No data
Right 1195282459 X:103349043-103349065 TTCCACCTTGGCATTTCAGTTGG No data
1195282447_1195282462 23 Left 1195282447 X:103349002-103349024 CCCTCCACTCTTCCTTCACCCTG No data
Right 1195282462 X:103349048-103349070 CCTTGGCATTTCAGTTGGCCAGG No data
1195282447_1195282458 6 Left 1195282447 X:103349002-103349024 CCCTCCACTCTTCCTTCACCCTG No data
Right 1195282458 X:103349031-103349053 GGATGTCTGTTTTTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195282447 Original CRISPR CAGGGTGAAGGAAGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr