ID: 1195283593

View in Genome Browser
Species Human (GRCh38)
Location X:103360388-103360410
Sequence GCCACACTCCTGTCTAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195283584_1195283593 30 Left 1195283584 X:103360335-103360357 CCTTGGCCCTCAGAGGGGTGGCA 0: 1
1: 0
2: 1
3: 24
4: 268
Right 1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1195283585_1195283593 24 Left 1195283585 X:103360341-103360363 CCCTCAGAGGGGTGGCACTCAGG 0: 1
1: 0
2: 2
3: 14
4: 133
Right 1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1195283587_1195283593 23 Left 1195283587 X:103360342-103360364 CCTCAGAGGGGTGGCACTCAGGA 0: 1
1: 0
2: 1
3: 29
4: 236
Right 1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195283593 Original CRISPR GCCACACTCCTGTCTAGGAT AGG Intergenic
900095546 1:938655-938677 CCCTCACTCCTGTCCAGGAGGGG + Intronic
901061847 1:6475286-6475308 CCCACCCTCCGGTCTCGGATGGG + Intronic
907427955 1:54392968-54392990 GCCACATTCCAGGCTAGCATTGG + Intronic
910323460 1:85976453-85976475 GCCACACTCCTGTGGGGGAGGGG - Intronic
920061472 1:203229715-203229737 GCAACACTCCTGGCTGGGGTGGG - Intronic
923265993 1:232314714-232314736 GCCTCACTCCTCTCTAGTCTTGG - Intergenic
1068947814 10:62747004-62747026 GCCAGACTCAAGTCCAGGATGGG - Intergenic
1077367760 11:2168009-2168031 GACAGACTCCTGTCCAGGGTTGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1080823545 11:35829122-35829144 GCCACTCTCCTGACTTGTATAGG + Intergenic
1085456812 11:76670255-76670277 GCCCCACGCCTGGCTGGGATCGG + Intronic
1089878950 11:121754860-121754882 GCCTGTCTCCTGTCTAGGAGGGG + Intergenic
1092170523 12:6371288-6371310 GCCACTCTCCTGAGTAGGAGTGG + Intronic
1092527017 12:9315574-9315596 GCCAGGCTCCTCTCTAGGAGAGG - Intergenic
1092540255 12:9416204-9416226 GCCAGGCTCCTCTCTAGGAGAGG + Intergenic
1093195633 12:16126621-16126643 GCCACATTCATGTCTGGAATAGG + Intergenic
1094512796 12:31106273-31106295 GCCAGGCTCCTCTCTAGGAGAGG - Intergenic
1096879232 12:54653929-54653951 CCCACCCCACTGTCTAGGATAGG - Intergenic
1101417245 12:104519125-104519147 GCCATACCCCTGTTTAGGGTTGG - Intronic
1105844000 13:24279400-24279422 GACACAATCCAGTCTAGGAATGG + Intronic
1107296818 13:38917922-38917944 GCCACACTGCACTCTAGCATGGG - Intergenic
1115214846 14:31004247-31004269 GCCACACTCCAGTCCAGCCTAGG + Intronic
1118503420 14:66385554-66385576 GCCTTACTCATGTCTAGGAGTGG - Intergenic
1119682523 14:76603567-76603589 GTCACAGTCCTGTTTAGGAGAGG - Intergenic
1121949040 14:98153280-98153302 GCCACATTTCTAGCTAGGATTGG + Intergenic
1122200114 14:100117335-100117357 GCCACACTCCTGCCCAAGAAGGG + Intronic
1122717010 14:103701924-103701946 GCCACAGCCATGTCTAGGGTGGG + Intronic
1130983487 15:88828994-88829016 GCCATACTTTTGTCTAGGATTGG - Intronic
1133615782 16:7475597-7475619 GCCACACACCCAGCTAGGATGGG + Intronic
1136776562 16:32874876-32874898 GCCGCCCTCCAGTCTAGGCTGGG - Intergenic
1136894053 16:33986637-33986659 GCCGCCCTCCAGTCTAGGCTGGG + Intergenic
1137507295 16:49065382-49065404 ACCACACACCTGTCTAGGCTAGG - Intergenic
1203078977 16_KI270728v1_random:1136985-1137007 GCCGCCCTCCAGTCTAGGCTGGG - Intergenic
1151758819 17:76089362-76089384 GCCACACTCCTGGCTGGGGGCGG + Intronic
1151951810 17:77358594-77358616 GCACCACTCCTCTCTAGGCTAGG + Intronic
1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG + Intronic
1155458352 18:26046371-26046393 GTCACACTCCTTTCTAAGTTTGG + Intronic
1156138787 18:34079408-34079430 TACACACTCCAGCCTAGGATGGG - Intronic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
1163223008 19:15935128-15935150 GCCACACTCTTGCCTTGGAAGGG - Intergenic
1165070589 19:33253059-33253081 GTCACACTCATGGCCAGGATGGG + Intergenic
1166856077 19:45783175-45783197 GCCACATTCCTGCCCAGGCTGGG + Exonic
925293631 2:2764078-2764100 GCCACCCTCCTGTAGAGAATTGG - Intergenic
926699196 2:15791362-15791384 GCCACACTCCTCTCAAGGCCTGG - Intergenic
928133001 2:28666931-28666953 GCCACACTCTTATCCAGAATTGG - Intergenic
933569250 2:83989943-83989965 GCCACATACCTGCCTAGGATTGG - Intergenic
940896926 2:159089737-159089759 GCCACAGTCCTGTCATTGATGGG - Intronic
941645309 2:168034052-168034074 CCTACACTCTTGTTTAGGATAGG - Intronic
945753202 2:213813927-213813949 TGCACAGGCCTGTCTAGGATCGG + Intronic
1169674120 20:8134582-8134604 CCCAGAATCCAGTCTAGGATTGG - Intronic
1170519755 20:17172133-17172155 GACACACTACTTTTTAGGATGGG - Intergenic
1172600439 20:36179320-36179342 GCCACCCTTCTGTCCAGGAATGG + Intronic
1172685333 20:36749634-36749656 GCCACACACAGTTCTAGGATTGG - Intergenic
1184626840 22:45741253-45741275 GCCACTCCCCTGTCGAGGGTTGG + Intronic
954991638 3:54845852-54845874 GCCAGGCTCCTGTGTAGGCTGGG + Intronic
957649211 3:82977970-82977992 GCAAAAATCCTGTCTAGAATTGG + Intergenic
961090022 3:124103033-124103055 CCCGGACTCCTGTCTAGGATGGG + Intronic
961162840 3:124744329-124744351 GCCACAGTCCTGTCTGGGTTAGG + Exonic
961321282 3:126078155-126078177 GCCACTCTCCTGGCTAGGCAAGG + Intronic
965634246 3:170765157-170765179 GCCAGACTCCTTTCTAGGTCTGG + Intronic
969008333 4:4039896-4039918 GCCAAACTCATGGCTTGGATTGG + Intergenic
971155802 4:24081678-24081700 GCCACACTCTTTTATAGGAAGGG + Intergenic
976388442 4:84484843-84484865 GACACTCTGCTGTCTAGGAGAGG - Intergenic
985631131 5:1014666-1014688 GCCACTGTCCTGTCTAGGCTAGG + Intronic
985782181 5:1877032-1877054 CCCTAACTCCTGCCTAGGATGGG + Intergenic
996822675 5:127648102-127648124 ACCACAATCCTGGATAGGATAGG - Intergenic
996827608 5:127703083-127703105 GCCACACTGCTGTCTGAGAGGGG - Intergenic
998344962 5:141454350-141454372 GCCATACTCCTTTCTAAGTTTGG - Intronic
1003468712 6:6408124-6408146 GTCACACTCCTTTCTAAGTTTGG - Intergenic
1006811346 6:36822346-36822368 GCCAGATTCCTGTCCAGGCTTGG - Intronic
1012332235 6:98007122-98007144 GCCACACCCCTGTATAATATCGG - Intergenic
1017375208 6:153760678-153760700 GCCACACTCCAGGCTGGTATTGG - Intergenic
1021190504 7:17613929-17613951 CCCACTCTGCTGTCTAGGGTTGG + Intergenic
1022456062 7:30559429-30559451 GCCACCCTCCTGTCTGGTCTGGG + Intergenic
1022614511 7:31915401-31915423 GCCACCCTCCTGGCTAGGCAGGG - Intronic
1023296551 7:38721121-38721143 GCCACACCTCTGTCTGGGCTGGG - Intergenic
1023393815 7:39733937-39733959 GCCACATTCCTCTCAAGGCTCGG - Intergenic
1024892340 7:54218464-54218486 ATCCCACGCCTGTCTAGGATGGG + Intergenic
1025086797 7:56029934-56029956 GCCACACTGCAGTCTAGCCTGGG + Intronic
1033994193 7:147325260-147325282 ACTACACTCCAGTCTGGGATGGG + Intronic
1034423104 7:150999400-150999422 GCCAGACTCCTGCCTTGGACAGG - Intronic
1034862791 7:154614133-154614155 GCCACACTGCTGTGCTGGATTGG - Intronic
1039573726 8:38606776-38606798 GCCACAATCCTGTATAGCATGGG + Intergenic
1040880974 8:52204136-52204158 GCCACACTACTGTCAAGATTTGG + Intronic
1044873846 8:96645302-96645324 GCCACACCCCTGACTGGGCTGGG - Exonic
1050985019 9:12071386-12071408 GTCACAATCCAGTCTATGATCGG - Intergenic
1052203634 9:25811724-25811746 TTCACACTCCTGTATTGGATAGG + Intergenic
1059175086 9:112162663-112162685 GCCACATTCCTCTCAAGGCTTGG - Intronic
1060354075 9:122887501-122887523 GCCTTACTCCAGTCTAGGGTAGG - Intronic
1193056539 X:77158115-77158137 GCCACACACCTGCCCAAGATAGG + Intergenic
1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG + Intergenic
1200103300 X:153699164-153699186 GCCGCCCTCCAGTCTAGGCTGGG + Intergenic
1200838329 Y:7754541-7754563 GCCACCTTCCTGTGTGGGATGGG + Intergenic