ID: 1195285034

View in Genome Browser
Species Human (GRCh38)
Location X:103376091-103376113
Sequence AGGGGCTACGTGGGCATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195285024_1195285034 12 Left 1195285024 X:103376056-103376078 CCCTCACTCTAAATTTTCTAGAA No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285022_1195285034 21 Left 1195285022 X:103376047-103376069 CCACCTTAGCCCTCACTCTAAAT No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285019_1195285034 26 Left 1195285019 X:103376042-103376064 CCTCCCCACCTTAGCCCTCACTC No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285018_1195285034 30 Left 1195285018 X:103376038-103376060 CCTGCCTCCCCACCTTAGCCCTC No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285020_1195285034 23 Left 1195285020 X:103376045-103376067 CCCCACCTTAGCCCTCACTCTAA No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285025_1195285034 11 Left 1195285025 X:103376057-103376079 CCTCACTCTAAATTTTCTAGAAG No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285023_1195285034 18 Left 1195285023 X:103376050-103376072 CCTTAGCCCTCACTCTAAATTTT No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data
1195285021_1195285034 22 Left 1195285021 X:103376046-103376068 CCCACCTTAGCCCTCACTCTAAA No data
Right 1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195285034 Original CRISPR AGGGGCTACGTGGGCATTGA TGG Intergenic
No off target data available for this crispr