ID: 1195285887

View in Genome Browser
Species Human (GRCh38)
Location X:103383303-103383325
Sequence CAGAACTGGGAGAAGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195285887_1195285892 -10 Left 1195285887 X:103383303-103383325 CCCACCCACTTCTCCCAGTTCTG No data
Right 1195285892 X:103383316-103383338 CCCAGTTCTGCACTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195285887 Original CRISPR CAGAACTGGGAGAAGTGGGT GGG (reversed) Intergenic
No off target data available for this crispr