ID: 1195286460

View in Genome Browser
Species Human (GRCh38)
Location X:103389382-103389404
Sequence GTTTATGTTGAAAAGTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195286460_1195286464 19 Left 1195286460 X:103389382-103389404 CCTTATGACTTTTCAACATAAAC No data
Right 1195286464 X:103389424-103389446 CATTGCTAGATCTGCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195286460 Original CRISPR GTTTATGTTGAAAAGTCATA AGG (reversed) Intergenic