ID: 1195289011

View in Genome Browser
Species Human (GRCh38)
Location X:103413838-103413860
Sequence CTGGCATGTGTGAACAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195289011_1195289015 19 Left 1195289011 X:103413838-103413860 CCGTCCTTGTTCACACATGCCAG No data
Right 1195289015 X:103413880-103413902 GTGGTAAGATGCACACTGCTTGG No data
1195289011_1195289014 0 Left 1195289011 X:103413838-103413860 CCGTCCTTGTTCACACATGCCAG No data
Right 1195289014 X:103413861-103413883 TAGCAGCTGCAGCTGCACTGTGG No data
1195289011_1195289017 30 Left 1195289011 X:103413838-103413860 CCGTCCTTGTTCACACATGCCAG No data
Right 1195289017 X:103413891-103413913 CACACTGCTTGGCTGCAACAGGG No data
1195289011_1195289016 29 Left 1195289011 X:103413838-103413860 CCGTCCTTGTTCACACATGCCAG No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195289011 Original CRISPR CTGGCATGTGTGAACAAGGA CGG (reversed) Intergenic
No off target data available for this crispr