ID: 1195289012

View in Genome Browser
Species Human (GRCh38)
Location X:103413842-103413864
Sequence GCTACTGGCATGTGTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195289012_1195289014 -4 Left 1195289012 X:103413842-103413864 CCTTGTTCACACATGCCAGTAGC No data
Right 1195289014 X:103413861-103413883 TAGCAGCTGCAGCTGCACTGTGG No data
1195289012_1195289016 25 Left 1195289012 X:103413842-103413864 CCTTGTTCACACATGCCAGTAGC No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data
1195289012_1195289017 26 Left 1195289012 X:103413842-103413864 CCTTGTTCACACATGCCAGTAGC No data
Right 1195289017 X:103413891-103413913 CACACTGCTTGGCTGCAACAGGG No data
1195289012_1195289015 15 Left 1195289012 X:103413842-103413864 CCTTGTTCACACATGCCAGTAGC No data
Right 1195289015 X:103413880-103413902 GTGGTAAGATGCACACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195289012 Original CRISPR GCTACTGGCATGTGTGAACA AGG (reversed) Intergenic
No off target data available for this crispr