ID: 1195289013

View in Genome Browser
Species Human (GRCh38)
Location X:103413857-103413879
Sequence AGTGCAGCTGCAGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195289013_1195289019 28 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289019 X:103413908-103413930 ACAGGGTGCTAATGGATGCCAGG No data
1195289013_1195289017 11 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289017 X:103413891-103413913 CACACTGCTTGGCTGCAACAGGG No data
1195289013_1195289016 10 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data
1195289013_1195289015 0 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289015 X:103413880-103413902 GTGGTAAGATGCACACTGCTTGG No data
1195289013_1195289020 29 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289020 X:103413909-103413931 CAGGGTGCTAATGGATGCCAGGG No data
1195289013_1195289018 20 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289018 X:103413900-103413922 TGGCTGCAACAGGGTGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195289013 Original CRISPR AGTGCAGCTGCAGCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr