ID: 1195289016

View in Genome Browser
Species Human (GRCh38)
Location X:103413890-103413912
Sequence GCACACTGCTTGGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195289012_1195289016 25 Left 1195289012 X:103413842-103413864 CCTTGTTCACACATGCCAGTAGC No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data
1195289011_1195289016 29 Left 1195289011 X:103413838-103413860 CCGTCCTTGTTCACACATGCCAG No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data
1195289013_1195289016 10 Left 1195289013 X:103413857-103413879 CCAGTAGCAGCTGCAGCTGCACT No data
Right 1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195289016 Original CRISPR GCACACTGCTTGGCTGCAAC AGG Intergenic
No off target data available for this crispr