ID: 1195289279

View in Genome Browser
Species Human (GRCh38)
Location X:103415835-103415857
Sequence TCTAGGGAACTGTAGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195289275_1195289279 22 Left 1195289275 X:103415790-103415812 CCTACTACCTACTTAGGCTATAC No data
Right 1195289279 X:103415835-103415857 TCTAGGGAACTGTAGCACAAAGG No data
1195289276_1195289279 15 Left 1195289276 X:103415797-103415819 CCTACTTAGGCTATACAGCATGT No data
Right 1195289279 X:103415835-103415857 TCTAGGGAACTGTAGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195289279 Original CRISPR TCTAGGGAACTGTAGCACAA AGG Intergenic
No off target data available for this crispr